header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4543
Transcript Name: rarga-203
Previous Name: rarga-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019702 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019702|OTTDARG00000016394|ZDB-GENE-980526-531 rarga|OTTDARP00000022099 rarg-003 LG_none BX546466.6,BX465864.12 Danio rerio protein_coding KNOWN, 686 bp
GTGTTTTGATTTATTTTCGTGCGGCGTTGATGCAAGTGTT
TTCGCGATGTGTTAAAAAGACGACTGGTTACTTTGTTCCA
TACCTTCACCAGGTGCAGTTGTACCTTGACGCACATACAA
GTGAACACGGAGCCGTGACGCAGATTGGTGAAGTTTGCCA
ACATTGTGACACAGGCTGTTGAAGCACACAACTGGCCCGA
CCAGCCTTTGGCAACCAACTGTCACCATGGCAACCAATCG
GGAACGGCAGGTGGGTCACATGACAGGCTTCCCACCTGCT
GTCTACCCCTTTGCCTTCAATTCCATGAGGAGCCACTCCC
CTTTCGACCTGCTGGCCAATAGCAATCTATTTGGGCGATT
TGGGGCGGACCTTCCCAAAGAAATGGCAGCTCTGTCGGTG
GAGACTCAGAGCACCAGTTCGGAGGAGATGGTGCCCAGTT
CCCCTTCCCCGCCACCTCCACCGCGTGTTTACAAACCCTG
CTTCGTCTGCCAGGACAAGTCTTCTGGGTACCACTATGGT
GTCAGTTCTTGCGAGGGCTGCAAGGGTTTCTTCCGTCGCA
GTATTCAGAAGAACATGGTGTACACCTGCCACCGTGACAA
GAACTGCCAGATCAACAAGGTCACGCGCAACCGTTGCCAG
TACTGCCGGCTGCAGAAGTGCTTCGAGGTTGGCATGTCCA
AGGAAG

rarga TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA rarga-201 (1) 2053
rarga-202 (1) 666
rarga-203 686
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rarga-203 Contained in:
OTHER rarga-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000019702 (1)
  • Ensembl_Trans:ENSDART00000143935 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO929448 (1) 908bp
    GenBank:CO796839 (1) 888bp
    CITATIONS (2)