ZFIN ID: ZDB-TSCRIPT-090929-4543
Transcript Name: rarga-203
Previous Name: rarga-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019702 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019702|OTTDARG00000016394|ZDB-GENE-980526-531 rarga|OTTDARP00000022099 rarg-003 LG_none BX546466.6,BX465864.12 Danio rerio protein_coding KNOWN, 686 bp
GTGTTTTGATTTATTTTCGTGCGGCGTTGATGCAAGTGTT
TTCGCGATGTGTTAAAAAGACGACTGGTTACTTTGTTCCA
TACCTTCACCAGGTGCAGTTGTACCTTGACGCACATACAA
GTGAACACGGAGCCGTGACGCAGATTGGTGAAGTTTGCCA
ACATTGTGACACAGGCTGTTGAAGCACACAACTGGCCCGA
CCAGCCTTTGGCAACCAACTGTCACCATGGCAACCAATCG
GGAACGGCAGGTGGGTCACATGACAGGCTTCCCACCTGCT
GTCTACCCCTTTGCCTTCAATTCCATGAGGAGCCACTCCC
CTTTCGACCTGCTGGCCAATAGCAATCTATTTGGGCGATT
TGGGGCGGACCTTCCCAAAGAAATGGCAGCTCTGTCGGTG
GAGACTCAGAGCACCAGTTCGGAGGAGATGGTGCCCAGTT
CCCCTTCCCCGCCACCTCCACCGCGTGTTTACAAACCCTG
CTTCGTCTGCCAGGACAAGTCTTCTGGGTACCACTATGGT
GTCAGTTCTTGCGAGGGCTGCAAGGGTTTCTTCCGTCGCA
GTATTCAGAAGAACATGGTGTACACCTGCCACCGTGACAA
GAACTGCCAGATCAACAAGGTCACGCGCAACCGTTGCCAG
TACTGCCGGCTGCAGAAGTGCTTCGAGGTTGGCATGTCCA
AGGAAG

rarga TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rarga-201 (1)    Ensembl 2053
rarga-202 (1)    Ensembl 666
rarga-203 686
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rarga-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000019702 (1),  Ensembl_Trans:ENSDART00000143935 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CO929448 (1) 908 bp
GenBank:CO796839 (1) 888 bp
CITATIONS (2)