Transcript

dgcr8-201

ID
ZDB-TSCRIPT-090929-4426
Name
dgcr8-201
Previous Names
  • dgcr8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019413 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019413|OTTDARG00000016189|ZDB-GENE-030131-3421 dgcr8|OTTDARP00000016423 CH211-106A19.4-001 LG_ BX088551.7 Danio rerio protein_coding NOVEL, 4703 bp
CTGCTCAGCTCTGCAGTGAAGATGGCGGAGAGAAGACACG
GCCATCTGAAGCCAATCAGCAGAAAATGCCTATGATTGCA
TGCTGGCTTCAGTAGACGCGTTGTCTAATTGGTACTGACA
GAAGATCTGGCCTCCTGGGATGGACAGTGCTTAGATATGG
GAACCATTTAAGCTGAATGCATTGTGATTTCCAATAATTG
AGACAGTAATTTCTAAAAAGCTGTCTACATTAATGAAAAG
AACAATGTAGTCAGCTTAGCATATTCAACCATGTACATGA
CTATTACTAAATAGGAGTTTCAAGCTTTATAATGTATACA
TGCATGTGTTAGGGCTGCAATTGTTTTAGTTAAATCGGGC
ACATCTCTCCCCAATTGTGTTCTTGTATCAGTTTTAGCAT
AGCTATTTTTAAGAAATTAAATATGGATGTAAATGAGATT
TTACCTCCCCTCCCATTGGAGCCACCTGACGCAGTATTGG
CGGGGAATGATTACAGTAAAGCACCTCCACCACCTCCCCT
GCAAACGTCCAGTGACGCAGAGGAAATGGACGTTAGCTCT
GGTGGTGATGGACACCAACACACCCCAGCAGTGGACAGGG
ACGAACAGCTTCTCCTCAACAAACGCACATTGTCTGTTAG
TAGCCGCCCATCAGATAGTACTGACCCCATGACTACTTGC
CCTAGAACCGCTCGCCATGCTCCCCCTGTTACCAAGTTTT
TACCTGATCTCAAACTCCTCAGAGACGTAAAGATCAGTGT
CAGCTTTTCGGACAGCAGTAAGAGCAAAGACAGGAAGGTG
TTGTACACTGGTTTTGGGCAGGTTAGCGATGAAGATCAGA
GCCTAGAGAGCATAAACGGAGAATTGCATGATTCTGTAAT
GATGAGAAGCGTGCCTGGCAGTTCAGCTATGAGCACTGGC
TTCATGGGTTTAGCTAGAACTAGAGAAGAGCTGGAGGCAG
AGCAGGAGAACAAGGTTGAGTTCGCTGTGCTGGATGACCT
GGAAGATTTCAGCGAGAACTTTCTGGAAGATGGAGAGCCA
AGTGCTTTCAGGTCTCAGATGATAGTTCAGCAGGAGCAAG
TGCACGAGGAGGACCTGAGTTACTCCTATGAGGAGGACTT
TGACAATGATGTAGATGCCCTGTTGGAGGAAGGCATGCCC
ATGCCCAAGAAGAGGCGTGTGGCTGAAGACAAATATGCTG
GAGACAGTGATCACCATTCAGACGGGGAGGCCGGAGTTCA
GCCTATGATGACCAAAATTAAGACCATTCTTAAGAGTCGT
GGTCGACCGCCAACTGAGCCATTACCTGATGGGTGGATCA
TGACATTCCATAACTCCGGCATTCCAGTCTACCTCCACCG
GGAAACCAGAGTTGTAACCTGGTCTAGACCTTACTTCCTT
GGAACAGGAAGCATTAGGAAACATGACCCACCAACCAGTA
GCATTCCCTGCCTGCACTACAAGAAAATGAAGGAACAAGA
AGAAAGGGAACAGAATGGAGAGGTGACTCCGACAGCGGAG
ATTTCTCCAGTCAAATCTGGGGAGGAGGGTATCTCACTGG
AGCGAGCCGATGAGCCTGACTCCACTGCCACTGAAGAGCC
CACCGGCAGACCAACATCAGAAGATCCGGATCTTGACCTC
ATGGAGCCAGGAGGGTCTTCTATAGAGGGGAAGGATGGCC
AAACCGGGGATACTGCACAGGGAGCATTGGGCCAGGTCAA
AGCCAAGGTGGAGGTCTGCAAAGATGAGTCTATTGAAATT
GAGGATTTTAGAAGCTACCTAGAGAAGTGCTTTGATTTTG
AGCAAGTGACAGTGAAGAAGTTCCGCACATGGGCTGAGCG
CAGACAGTTCAACAGGGACATGAAGAGGAAACAGGCTGAG
TCTGAGAGGCCCATCCTACCAGCCAATCAGAAGCTCATCA
CGCTGTCTGTTCAAGATGCCCCCACAAAGAAAGAGTTTGT
CATCAACCCAAATGGGAAGTCAGAAGTGTGCATTTTACAT
GAGTATATGCAAAGAGTACTCAAAGTGCGACCAGTTTACA
ACTTTTTTGAATGTGAAAACCCAAGTGAACCCTTCGGAGC
CTCAGTGATTATAGACGGTGTTACATACGGCACTGGAACA
GCTAGTAGTAAAAAACTTGCCAAGAATAAAGCTGCTCGAG
CAACACTGGAAATCCTCATTCCTGACTTTGTGAAGCAGAC
GTCTGAGGAGAAGCCCGTAGAGGGAGATGAACTGGAGTAT
TTTAATCATATCAGTATTGAAGATTCAAGGGTGTATGAGC
TGACCAACAAAGCAGGTTTACTCTCACCATATCAGATCCT
TCATGAGTGCCTTAAGAGAAACCATGGCATGGGAGACACC
AGCATCAAGTTTGAGGTGATTCCAGGAAAGAACCAGAAGA
GTGAATACGTCATGACATGTGGGAAGCACACTGTGCGCGG
CTGGTGTAAAAATAAGCGAGTCGGAAAGCAGCTGGCGTCA
CAGAAGATTCTCCAGATGCTTCATCCTCATGTGAAGAACT
GGGGCTCACTGCTGCGCATGTATGGCAGAGAAAGCAACAA
AATGGTTAAAAAGGAGAATTCTGATAAGAGTGTGATTGAG
CTTCAGCAGTATGCCAAAAAGAACAAGCCAAACCTTCACA
TCCTCAACAAACTGCGAGAGGAAATGATGAAACTGGCTCG
AGAAAGGGAGGAGGCAAGAAAAAAGCCGAAGATGACTATA
ATGGAGTCTGCTCAACCTGGCAGTGAACCTCTGTGTACTG
TTGACGTCTAGCAAACCCTCGTCCAGCATGTTATGATAGC
ACTGACCAATGGTAACAGTTGTGTAACAAAAGGTCATCGT
ACCATTACTGACTTATGCATTCATTTCCAGTGCAAATGGC
AATACTAGTTACATTTTTATTCAAATTTTGAGCCCAATTC
AGTCATTGTCCATAACATTTGTGTTCGGTAACGGTTGTAT
ACATGCACTGCGGGCTGATAGAACGAGCATCAAATACCTC
CAGATGCACTTCTGCACCTGAGAGTGCACAAACATAATGA
CGGCGTTTGACGTCATAGCCTACACAAATTTAGGTATGTG
GTAAAATAATGTATGTTAAATAAGTATTGTGCTTTTTTTT
TTTTTTTTTTACATTTGTGGCTTTTAGATGTTAATAAAAA
TATTGTTTTCCCTTTCTTAACCACAAATTTCATTTCATAT
TTTCAATGAAACTACAGATTTCACATGGCTGACTGTATCT
CTGTAATGATGCATTTGTCATTGGTTCATTTATGTCAGCT
GCTGTGGCATGCAGTGCACGTTTTATCTGGAAAATAGGGT
TTATTATGACTTAGGTGTGTGTGTGGTATTTCAGTGGCTA
TTTTTAGTTATTGGCACGTGAAGCATTTTAAATGTTGTTT
ATTTTAAAGCATTTCATGTTGTGCACACTGCCAACTGCTG
TTGAGAAATGCACTAACGTTGAAAGCATTTGCTCGTGAAG
TGATCACGCTTTTAGTTTTTATTAAAGATGATGCATTTAG
GCGGTCACTTTGACCAACTGCTCTACTTGTTCAGAAAGCA
CTGCAGAGAAAAGGCAAGCACAAGTGTGTGAGGTACTGTA
GGTTGCTGATTAAGAGAACATCAGGGAGATAACATGCTCG
TGTATTTCTTTTTTTGTAAGGTTTTTTTTTTTTTTTGGTT
ACATTTCCGTTCTAGAGACTGGTTGGTAATCTTCATTAGG
AAATAAATAAACGTTGCCTTAGTTGTCCCCATCGTTTCAG
TCGTGGTACCTTGTGTTTCAAAAGGGAAACGCTTCACTTG
AGTCTGCATTTGTGATGCTGTATGTTACGTATTTGCCGTG
GAGTGACGCTTGCTTTCTTGCATTGATATTTTAGAGGAAA
TGCCTTCTACGCATGTGCTTTTTTGCATTTGTCTTAAATA
TTCCTGTATGGTTTTGTGGACATTTGCTAAAGTTATTGTG
TGCAGATCTTTATCACGTTGGTATATGAAATAGATTTAAT
CATATTCTTTACTTCAAAGGGTAGAGCACCTACAAAAAGA
AAGGTGGTGACTTCGTACCTCGAAGAAAATCAAACCATGC
TTATATTCAATAGCTTGAAGAACAGTGTGAACCAAAGCTT
TAAGTCTTATGCATTTTTATAGAATATTGCTGCATAGCTA
CTCATAAAAAAATATATATATATAACTTACATGCATTGAA
CAATATAGAAAAAAAGATGCAATAACTGCTGAAATAAAAT
ATGGTCCCTGTTTGAAGAAAACTACTCCGATGAGAGAAAA
AAAAGATCAAACATTTCTGGCCTTAAGATTTTAAGGAAGA
TAAAATAATCTGGTTTTCTTGGGACAGCGACTAAACACTG
CAGTGCACTGTCATTTTGAACTTTAGTATTTTAGTTTGTG
TGCTTCTGAATGTTTACTGCGTTTGTGAAGGATCTTTCCT
GTTTTTCATGAGCACAAGGCTGCTGCCACACAGAGAATAT
GCTTTCCCACTTAACGTCTGGAGTGTACGACTTGTCCTGT
TCAGTCTTGCCAAGTGTGTATTAGCCGTATGAAGAGATGT
GTGCTTTTTAGTCACTGTTGTCGAAGGGATGGTAATGTTG
GATGATTTAGCTGCAAGTATCGCTGCCTAAACAATGTTTT
AATGTGACACATGATCGCTGATACGCAGTGATTTGTTTAT
GCAAATAAATTGATGCCCAGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations