Transcript

ap1b1-201

ID
ZDB-TSCRIPT-090929-4424
Name
ap1b1-201
Previous Names
  • ap1b1-001
  • si:ch211-149d1.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019411 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019411|OTTDARG00000016187|ZDB-GENE-061025-1 ap1b1|OTTDARP00000016421 ap1b1-001 LG_ BX664747.12 Danio rerio protein_coding NOVEL, 4387 bp
TGTAAGGTGGGAGGGAAGGAAGAAGGCCGACTTGTACACA
CTCACTCTTCACTTCGGAGAACCGAGGCTTGGGATCCAAG
ATGACAGACTCCAAATATTTCACCACTACCAAGAAAGGAG
AGATCTTTGAGCTGAAGGCAGAGCTCAACAGTGATAAGAA
AGAGAAGAAGAAGGAGGCTGTGAAGAAGGTCATTGCATCT
ATGACCGTTGGAAAAGATGTCAGTGCTCTGTTTCCTGATG
TTGTCAACTGCATGCAGACAGATAACCTGGAACTGAAAAA
GCTGGTCTATCTGTACTTGATGAATTATGCCAAGAGCCAG
CCAGACATGGCCATTATGGCAGTCAACACTTTTGTGAAGG
ATTGTGAGGACCCGAATCCTCTGATCCGAGCTCTAGCTGT
GCGCACGATGGGCTGCATCCGAGTGGACAAGATCACGGAG
TATCTGTGTGAACCTCTGAGGAAGTGTCTAAAAGATGAAG
ACCCTTACGTGAGGAAGACTGCTGCAGTTTGTGTCGCCAA
GCTCCATGACATTAACGCCCAGCTGGTAGAAGACCAGGGC
TTCCTGGACACACTGAAAGACCTTATCTCTGATTCCAACC
CTATGGTGGTAGCAAATGCAGTAGCAGCTCTGTCTGAGAT
AGCAGAGTCTCATCCTAACAGCAACCTTCTGGACCTGAAC
CCTCAGACCATTAATAAGCTCCTGACAGCCCTTAATGAAT
GCACTGAATGGGGCCAGATCTTCATCCTTGACTGCCTGGC
CAACTACACGCCCCGTGATGACCGCGAGTCTCAGAGTATC
TGCGAGCGTGTGACTCCACGGCTTTCTCATGCTAACTCGG
CCGTGGTGCTGTCTGCTGTGAAGGTTCTGATGAAGTTTAT
GGAGATGCTGCCGAAAGATCTAGATTATTATGGCACTCTG
TTGAAGAAACTTGCTCCTCCATTGGTAACGCTGCTCTCCG
CTGAACCTGAACTGCAGTATGTTGCCCTGAGGAACATAAA
CCTCATCGTACAGAAACGGCCTGAAATCCTAAAGCATGAG
ATGAAGGTTTTCTTTGTGAAATATAATGACCCAATCTATG
TCAAGCTGGAGAAGCTGGATATAATGATCCGCCTGGCCTC
TCAGGCCAACATTGCTCAGGTGCTGGCTGAGCTAAAGGAA
TATGCCACTGAAGTGGATGTAGACTTTGTGCGTAAAGCTG
TACGAGCCATTGGCCGCTGTGCAATTAAAGTGGAGCAATC
AGCAGAGCGTTGTGTCAGCACACTGCTTGACCTCATTCAG
ACCAAGGTCAATTATGTGGTGCAGGAAGCCATTGTGGTGA
TCAAGGACATCTTCCGCAAGTACCCCAACAAGTATGAGAG
CGTGATTGCCACTCTGTGTGAGAACCTGGATTCTCTGGAT
GAGCCCGAGGCAAGGGCAGCCATGATCTGGATTGTGGGTG
AATATGCAGAGAGGATTGACAATGCCGATGAGCTGCTGGA
GAGCTTCCTGGAAGGCTTCCATGATGAAAGCACACAGGTG
CAGCTTCAGTTGCTGACAGCTATTGTGAAGTTGTTCCTGA
AGAAACCCACTGAGACCCAGGAGCTTGTGCAACAAGTGCT
CAGTCTCGCCACACAGGATTCTGATAACCCTGACTTGCGT
GACCGTGGCTACATCTACTGGCGTCTGCTCTCCACGGACC
CTGTGGCTGCTAAAGAGGTGGTTTTGGCTGAAAAGCCACT
GATCTCAGAGGAAACAGACCTGATTGAACCCACCCTGCTG
GACGAGCTCATCTGCCACATTGGGACTCTGGCTTCAGTCT
ACCACAAACCTCCCAGTGCTTTTGTGGAAGGCAGCCGTGG
TGTTCAGCACAAGAGACTTCCTGCTCGTGCTGGCTCTGGA
GAGAGTGCCGAGAGCCCTGAAGTTGGCCAGTCTGGAACCT
CTGAAGCTCCACCTGCAGTCATTCCATCACAGGGCGATCT
CCTGGGGGACCTTTTGAACCTGGATCTGGCCCCGGCCACA
ACCACTGTTCCTTCAGTTCAGCCTTCAATGCAGATGGGAG
CCATGGACCTACTTGGAGGAGGTCTGGATAGTCTGCTGGG
AGGAGACATCGGTGGAAGTCCTTCGATGGGTGCTGCTTTG
GGGGCCCCTGCAGCCATGCCTGCTGCTCTGAGCAATGCTC
CGGCTGTTGGAGGTGGATTGGGAGACCTTTTTGACCTCGG
TGGGGGTGTTGGCATGCCAACGGGATTCTATGTTGCTCCT
AAAACTTTGTTTTTACCAGCAATGAAGGCTAAAGGGCTGG
AGATTTCTGGGACATTTGCCCGACGTGGCGGCATCATTCA
GATGGATCTGTCTCTCACCAACAAAGCCATGAGCGTTATG
ACTGACTTCGCCATTCAGTTCAACAGAAACAGTTTTGGTT
TGGCCCCTGCTGGCCCCCTGCAGGTTCTGACTCCTCTGAC
CCCAAATCAGACGATTGATGTCAGTCTGCCTCTCGGCACA
ACTGGCCCTGTCATGAAAATGGAACCACTCAACAATCTCC
AGGTAGCTGTGAAGAATAACATTGACGTGTTCTACTTCAG
CTGCCAGTATCCTCTTAGCCTGCTCTTTGTAGAGGATGGA
AAGATGGAACGTCAAGTGTTTTTGGCCACCTGGAAGGACA
TCCCAAATGACAACGAGGCACAGTTCCAAATCAAAGACGT
ACACCTCAACTCAGATGCAGCCAGCAACAAGCTGCAGGGC
AGTAATATCTTCACCATAGCCAAGAGGACAGTGGATGCCC
AAGACATGCTCTACCAGTCCATCAAACTCACCAATGGCAT
CTGGGTGCTGGCAGAAATGCGTGTGCAAACTGGCAACCCT
AACTATACGCTGTCAATAAAGTGCAGAGCGCCAGAGGTCT
CTCAGTTTGTGTACCAGTGCTATGAGCTGGTGCTGAAGAA
CTGAAGAAGTTTGGGGGAAACCAGAAGGATCTCACCGGGA
GTTCTTCGGGTGACTGAAACCCAAAACTCGATTGGACCAG
TCAGAGGAAGAACCCCCCCACTGTCTTACTTTCCCTCAGA
CTGTGCTTTCACAGCATTGACTGAATCCCAAGGAATTTTT
CCTCATTATTCGTTTCCATTCCTAACACCCTCTGTTTCCA
TTCTCATGATATCTAAAATGCAACATGAATGATAAAAAAT
ATCAACTTTATTCCACAGAAGTTCTTCTTAGCAAATCTCA
TTGCCTCTACTGTATGATCGCTTCCCTGTGCGTTCCCAGT
AAACGTTTTTTCACCACTCATGGTGGGCAAACATGAGGGA
GATCTCGCTTTTAACCATCTAGTGGTGGGAAGGGTTTGTT
TTCCACAGTTGAGAGAAACCTTCAACACTGCTGTTTTTAA
TTTAGCTTTCGTCATCAGCATTTTTGCTTGAAAATTCAAA
GTTTAAGTCTTGATTTATTTATTTTCTTCAGTTTCGGTAA
CGCTCGTCTCTTTCTTCGATAATTTTGGTCTTTCCATTAT
TTCTTTGAAGGGAATGCTGTGTGTTTATGCAGAAGCACTA
CACCATTGCTGAGTATAACTTGTCTTTGGATTCAGCATCT
CTATATTTGGTTAAGATTACGATTGCAGTCATGTTTTGTT
TCTACAGTTTATTTTTATTTAGGTTATTTTTAGTCACTAC
TGTGTGTCGTGTGCTGCGTACCAGTTATGAGTGTGTGAGA
GTGAGTTGGAGGTGCAACATTCTGCATGTTCTGTTCCCTC
TTATGGCAATCTTCCCTGTCCTCCATCAGTCTGTTTGTGT
ACACATGCCCACATATCCTGGAGGTTGTTGATTTAGTGTC
TGCGCTTTTTGTTGCAAGCAAGATAAACTGCTCAATCTGT
GAGGGAGACTCTACTCGGCTGTTCAGATTAATTTGCAGAA
GGTTATGGTTATGGTTGGAATATCTCAGATAACACTGAAC
ATGATGCGTTTAAGGTCTCATACTTGGCAAAACAACTTGC
TCCACCATTCTTAATGGGACTTATGACAGGAGTTAAGGCT
AAACTTTTAAAATCGTCTTATTTCTTTTCTTTTTTTTTCT
TTTTTTTTATACATGTTTCCAATCAGGACAAACTACGTAT
CTCTCTCAAGATAAAAAAAAAAAAAAAAAAAACACACCAC
CAGACTAAATACTGCTGAACTGACACACAAAATGCTCTAT
GCGCTTAAATATTTCCAAGTAATATTGATGATTGTTTTTC
TTTTAATCATAGTTTGGTGTTTGATTCTGTTTGTGTGTGT
GTGTGTGTGTGTGTGTGTTATGTTCTGTGGGCTTAGTCAT
GAGGGTGACTAAAAGGAGATGTCCAGCAAAGAATTTTGCT
TTACGTTTTATTGAGTTCTGTCATGAATGCATCATCTGTT
AAGCAAATTAAAAAAGTATATTACCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations