Transcript

rrm2b-202

ID
ZDB-TSCRIPT-090929-4397
Name
rrm2b-202
Previous Names
  • rrm2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019329 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019329|OTTDARG00000016122|ZDB-GENE-030616-614 rrm2b|OTTDARP00000016346 CH211-215I13.3-001 LG_ AL807244.7 Danio rerio protein_coding NOVEL, 1289 bp
AATTTTCAATGACAGTCGACGAGCAGACACCGCAGCTTCA
CTGCTGCTGACCAAACACCATTATAAACATGAACTCCTGC
ACAAGCAACACTCCGACGGTTATTACGGGATATCAGAACG
GTCACAAGGATGTCGACCCAAACAGTGTTGAAGATGAGCC
TCTGCTCAGAGAGAATCCCAAACGATTTGTCATTTTCCCT
ATTCAGTATCCAGACATCTGGAAAATGTACAAACAAGCAC
AGGCTTCTTTCTGGACAGTTGAGGAGGTGGATTTATCAAA
GGATTTAACTCACTGGGACGGCCTGAAGTCTGAAGAGAAA
CACTTCATATCACATGTATTGGCTTTCTTTGCGGCAAGTG
ATGGGATAGTCAATGAGAACCTGGTCCAGAGGTTCAGTCA
GGAGGTGCAGCTCCCCGAGGCTCGTTCCTTCTACGGCTTT
CAAATATTAATTGAGAACGTGCACTCAGAGATGTACAGCA
TGCTCATTAACACCTACATTAGGGATCTGAAAGAGAGAGA
CTATTTGTTTAATGCAGTTCAGACCATGCCCTGTGTGAGG
CGGAAAGCAGACTGGGCCTTACAGTGGATTTCAGACACAA
ACTCAACTTTCGGTGAGCGGTTGGTAGCGTTTGCAGCAGT
GGAAGGCATTTTTTTCTCAGGATCATTTGCTGCCATCTAT
TGGTTAAAGAAAAGAGGCCTGATGCCTGGACTCACCTACT
CCAATGAGCTCATCAGCAGAGACGAGGGCCTACACTGCAA
TTTTGCCTGTTTAATATACAGTTACTTAGTGAAAAAACCT
TCTGTTGACCGAGTGAATGACATTATCGCTAAAGCTGTGA
GCATTGAACAGGAGTTTCTCACAGAAGCTTTACCAGTCAA
TTTGATCGGGATGAACTGCTCTCTCATGAAGCAGTACATT
GAGTTTGTTGCTGACCGCTTGCTGACCGACTTAGGATTGC
CCAAAGCTTACTGTTCAGAAAACCCCTTCGACTTCATGGA
GTCCATTTCATTGGAGGGGAAAACAAATTTCTTTGAGAAG
CGAGTGGCCGAATACCAGCGACTTGGAGTGATGTCAAATG
TTAAGGATTGTGAATTCACACTGGATGCAGATTTCTGAAG
AACTAGATGATGTTGTTTATTTATTTGGATGCTGTTACAT
TATGTTCTGAAAGTGAGAAATATAGTAAGCTTTTAAGGTT
TGGTTTTATGAGTTTTGTTATGAGTTTTTCATCTGGTGTA
AAGCTTCAACTTTTAAAGGTGTTTTAGATTAAAACGCAGC
CAGTATTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations