Transcript

dao.2-201

ID
ZDB-TSCRIPT-090929-4374
Name
dao.2-201
Previous Names
  • dao.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000019279 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019279|OTTDARG00000016080|ZDB-GENE-040426-2634 dao.2|OTTDARP00000016300 DKEY-72N1.6-001 LG_ BX511005.6 Danio rerio protein_coding NOVEL, 1295 bp
CGACAACGACCTGTTGTTAAGACCGACATCAAGAAAACTT
CGACATGAAGGTGTGCATCATTGGCGCGGGGGTCATCGGT
CTCTCCACTGCTCAGAGCATCTACCAGCACTTCCACAGCA
GAGTCTCTCCTCTCACCATAGAGGTTTATGCTGATATCTT
CACCCCTCTGACCACCAGCGATGGGGCAGCTGGACTCTGG
CAGCCCTATCTCTACGACAAGGGCAACGTCAAAGAAACTC
AATGGAACAAAGAGACCTTTAACTATCTACTGAGTTTCAT
CAACTCTCCAGATTCAGTGAAAATGGGAATTTTCCTTCAG
TCTGGCTACAATCTGTGTGCTGAACCAATGCCGGAGCCGT
CGTTTAAACAAGCTGTTTTGGGTTTTCGTCAGCTTTCTAA
ACGTGAACTAGAGATGTTCCCAGGTTACAGTTTTGGCTGG
TTCAACACTGCTCTCATGATTGAAGGAAAGACGTATTTGC
CCTGGCTCATGAACTGGTTAAAGCAAAGAGGCGTCGCATT
TTTTCAGAGGACGATTGACTCATTTAAAGAGTTGTCAGAC
AGTGGTGCTGATATGATCATCAACTGCTCTGGTGTTCGCT
CAGGAGATTTGCAGCCTGACCCTGAGCTCCAGCCAGCCAG
AGGACAGATCATTAAGGTAGACGCCCCCTGGTTAAAGCAC
TGGGTCATCACGCATGATTCCACATCAGGAGTCTATGATT
CACCGTACATCATTCCTGGGAGTCGTTTGGTCACAGTTGG
TGGAGTTTTCCAAGTGGGAAACTGGAATCGGATGAACAGT
TCAGTTGACCATAAAGGAATCTGGGAAGCCGCCTGCAAAC
TTGAGCCCAGTCTACAGCATGCACGGATAGTGGAAGACTG
GACTGGTCTCAGACCTGCACGGAGTAAAGTCAGACTGGAG
AGAGAAGCCATACGATCTGGAGGACACTCATTTGAGGTCA
TCCATAACTATGGACATGGAGGTTTTGGGCTAACCATCCA
TCGTGGATGTGCTGAGGAAGCTGCTCGGCTCTTTGGACAG
TTCCTGGAGCAGAAAGGATTGCTAGCAGCACAAGCTAAAT
CACGCCTTTAACAGATCTGAGCCACCAGATAGCATTATCA
ATAATCTATAATCTTAATGCACATCGTCCTACCAATTCCA
AAAGATCATTTGTCCACATTTCTCTGCCAGTATAGACACA
CATACTCTCTTCTTTTTTTAAGCATACTTTATTGTTATCG
TACATGTACATCCAGTGCAGTGGCAAGAAAATCAGTGCAC
ACAGACACAAAACGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations