ZFIN ID: ZDB-TSCRIPT-090929-4373
Transcript Name: pxmp2-002
Previous Name: zgc:92599-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019278 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019278|OTTDARG00000016079|ZDB-GENE-040912-184 pxmp2|no_translation DKEY-72N1.1-002 LG_ BX511005.6 Danio rerio protein_coding NOVEL, 768 bp
GTGTGTGTGTGTGTGTGTGTAAAAAATAGCCATTTTCTTT
CTTTCTTACAGTGGTATTCTGTCTGCTTTGGGAAATCTTT
TGTCTCAAGTTTTGGAGTACCAGAAGAATGTCAAGGAAAA
TAGTCCCAAAAAGAAAATCAGCATTCTGGGACCTGTACAC
TTTGCAATTTATGGACTTTTTATCACTGGTCCAGTCAGTC
ATTACTTCTACCATCTCCTGGAGGTCCTGTTACCAACCAC
TGTCCCATACTGCCTCATCAAGCGCCTTCTGCTGGAACGT
CTGATATTCGCCCCTGCTTTCCTCCTGCTCTTTTATGTGG
TTATGAACGCTTTAGAGGGCAAAACACTCGCAGATGTTCA
AAACAAGCTTAAAACAAGTTACTGGCCTGCGATGAAGATG
AACTGGAAGGTCTGGACGCCGTTTCAGTTTATCAATATCA
ACTATGTACCTGTACAGTTTCGAGTGCTGTTCGCCAACAT
GGTTGCCTTATTTTGGTATGCCTACCTGGCCTCTGTCAGG
AAATGAAAGCACAAAACCAGTTACAGCAAGCTTATCTTGG
TTTACGGTGAATCCAGGTTGTGCCTTACTGCAGTGTTTCT
CAACCACATTCCTGGAGAAACACCAACACTGCATGTTTTG
GATGTCTCCTTTGTCTGTCCCACCTATTACAGGTCTTTCA
GTCTCTGCTAATGAGCTGAGAATCTGAATCGGGTGTGTTT
GATTAAGGAGACATGAAAAATGTGCAGAGCTAGTGGTCCA
CCAGGAAT

pxmp2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pxmp2-201 (1)    Ensembl 1344
ncRNA pxmp2-002 768
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pxmp2-002 Contained in:
[BAC] DKEY-72N1 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000019278 (1),  Ensembl_Trans:ENSDART00000138049 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)