ZFIN ID: ZDB-TSCRIPT-090929-4372
Transcript Name: pxmp2-201
Previous Names: pxmp2-001, zgc:92599-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019277 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019277|OTTDARG00000016079|ZDB-GENE-040912-184 pxmp2|OTTDARP00000016299 DKEY-72N1.1-001 LG_ BX511005.6 Danio rerio protein_coding NOVEL, 1344 bp
AGGAAGCACTTGCACTTTGTAAAAAAAAAAAACAACAGAA
ATTTTCACTCTTATGATATAAGTGCCCAGGCGCTGCTCCA
GTAAGTGACGATGCCAACGCAAAGCGTACTTGTCCGAGAC
CCCTCTTTGCTGGCGAGGGCACTTCAGCAGTATTTGAGCT
TGTTAAAGAAATATCCAATCATCACCAAATCGGTTACGAG
TGGTATTCTGTCTGCTTTGGGAAATCTTTTGTCTCAAGTT
TTGGAGTACCAGAAGAATGTCAAGGAAAATAGTCCCAAAA
AGAAAATCAGCATTCTGGGACCTGTACACTTTGCAATTTA
TGGACTTTTTATCACTGGTCCAGTCAGTCATTACTTCTAC
CATCTCCTGGAGGTCCTGTTACCAACCACTGTCCCATACT
GCCTCATCAAGCGCCTTCTGCTGGAACGTCTGATATTCGC
CCCTGCTTTCCTCCTGCTCTTTTATGTGGTTATGAACGCT
TTAGAGGGCAAAACACTCGCAGATGTTCAAAACAAGCTTA
AAACAAGTTACTGGCCTGCGATGAAGATGAACTGGAAGGT
CTGGACGCCGTTTCAGTTTATCAATATCAACTATGTACCT
GTACAGTTTCGAGTGCTGTTCGCCAACATGGTTGCCTTAT
TTTGGTATGCCTACCTGGCCTCTGTCAGGAAATGAAAGCA
CAAAACCAGTTACAGCAAGCTTATCTTGGTTTACGGTGAA
TCCAGGTTGTGCCTTACTGCAGTGTTTCTCAACCACATTC
CTGGAGAAACACCAACACTGCATGTTTTGGATGTCTCCTT
TGTCTGTCCCACCTATTACAGGTCTTTCAGTCTCTGCTAA
TGAGCTGAGAATCTGAATCGGGTGTGTTTGATTAAGGAGA
CATGAAAAATGTGCAGAGCTAGTGGTCCACCAGGAATATG
GCTGAGAAACACTGCCTTACTGGGTCAGTTTCTGTCAAAT
AACTGCTATATAGATAATTGTAATACTATTTTCACTAAAT
TATTTTAAAAAATCTGCCCAGAGATTGAATCTGCTCATAC
TAAATGTCTTTCTAATGGTTGCAAGTACACTGAACATGAA
TTAATCAATGTTGTAATTGATTAATTAAATATATAAATGC
TTACTGAGACAAAATAATTTTGTAAGTAGTCATTACTACT
GCTATTGTCAGCAGTCTTGAACTCTGTGTTATTCTAAAAT
CTATTCTAAAGTCAAATCTACAAGAAAAGCAGTGACCTTG
CTAATGTTATGTACTCGTATTGCTCTGATTAGATGTTTTT
GATATTGGGTATTAAATAAAATATGCCAGCACACACACAC
ATCAATAAAAAGCGTTTTTAAAAA

pxmp2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pxmp2-201 1344
ncRNA pxmp2-002 (1)    Ensembl 768
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pxmp2-201 Contained in:
[BAC] DKEY-72N1 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000019277 (1),  Ensembl_Trans:ENSDART00000026516 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK027822 (1) 1154 nt
GenBank:CF550286 (1) 798 nt
GenBank:CK024615 (1) 728 nt
GenBank:BM958352 (1) 613 nt
GenBank:CD604672 (1) 480 nt
CITATIONS (2)