Transcript

foxn4-201

ID
ZDB-TSCRIPT-090929-4322
Name
foxn4-201
Previous Names
  • foxn4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019172 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019172|OTTDARG00000015990|ZDB-GENE-990415-277 foxn4|OTTDARP00000016202 foxn4-001 LG_none BX510917.5,BX510366.5 Danio rerio protein_coding KNOWN, 2752 bp
ATGGCAATCACTGCTGAAACTGTTCCAGCTCTCCGGCTTC
ATAGGGATTTCTATTCATTTTTTCCCGAGATAATGTTTTT
TTTAGGGATTTATAGTATGTAAATATGGCTTTTATATAGA
AGGATTTTTTTTCTGAACTCCAATTTCTGTGTATATTTGG
ACATAATTAAGTTGGACCGGACCCGAAAAGGCGCACCTGT
GGACTGCACAAAGAAAACTAGGAAGAAAAGAGCAAGTCTT
TGAGAAAGAAAGGTATTGATTAAACAAAAACAGTAAAGAC
CAGTCGGGTGAGATGCTCTGACAGATAATCTTCGTGATTG
TGCAGGCAAGGCAACAGCTGTCAGTCAGAGCGCGAGACCC
CCTCCTCTCATCACGGCTCGCGCTGCGCGTGCACACAGTG
CGCATGACCGTCCAGAGCAAACTGCAGGGACGAGGGAAAT
TTAAAAAACGGTTTTTTCGTGCGGGACAACAAGTGCCCCG
ACCAACACTAGAGCTTTCCTCCGTCTGGTTATCAAAGATT
TTCTATAACCCAGAACAACATCATAACAAACAGAAGATGA
TTGAAAGTGGAATTACGACCAGGATGTCGGGAATTCATGA
AAACCCCGGACAGAGTCACCACACCTCCGCACAAGACTAC
AGACTCCTGACTACAGACCCTTCGCAGCTGAAGGACGAAC
TGCCTGGTGATCTTCAATCTCTGTCCTGGCTCACCTCTGT
GGATGTTCCCCGACTGCAGCAGATTGGGGGTGGACGGCCA
GATTTCACTAGCTCTGCTCAAAGCAGCCTACTGGAGCGAC
AGACAGCTCAGTTGAACAGCATGACGGTAGCAGGAGGAGC
AGGATCTGCGATTCATCTACAGAGTGAAATGCAGCACAGC
CCTCTGGCCATCAACAGCATGCCCCAGTTTTCCCCTGGGT
TTCCGTGTGCCGCATCAGTGTACCAGACGGCTCCTCAGCA
GGTGCTCACTTTCACCCAAGCAAACCAACAGTGTTCACCC
GGTGGACTGTATGGAAACTACAACAGCCAGAATTTGTTTC
CTCAACCCCGGATTACTGCTCACAGCCAGGACCTGCAGCC
CAAGTGTTTCCCCAAGCCCATCTACTCTTACAGCTGTCTT
ATTGCCATGGCTTTGAAGAACAGCAAAACGGGCAGTCTTC
CAGTGAGTGAGATCTACAGCTTTATGAAAGAGCACTTCCC
TTACTTCAAGACAGCACCTGACGGATGGAAGAACTCTGTA
CGACACAACTTGTCCTTGAACAAGTGCTTCGAGAAGGTAG
AGAATAAGATGAGCGGCTCCTCCAGAAAGGGATGTCTTTG
GGCGCTCAATCCGGCAAAGATTGACAAAATGGAGGAAGAG
ATGCAGAAATGGAAACGCAAAGATCTTCCAGCCATCCGTC
GCAGCATGGCAAATCCAGATGAATTAGACAAACTCATCAC
AGACAGACCAGAGAGCTGCAGACAGAAGTCTGTTGACCCT
GGCATGACCCGCCTGCCTAGCTGCCCACCAGGGCAGACCC
TCCCACTAGCAGCTCAGATGCAACCACAGCCTGTGGTCAC
TCTGTCTCTGCAGTGCCTCCCCATGCACCAGCACCTTCAG
CTGCAGCTCCAGAATCAGTCTCGCCTGGCTCCGTCCTCCC
CGGCTCCTGCTCAGACACCCCCTCTCCACACCGTCCCTGA
CATGACAAACAGCTCGCTCCCCCAGCATCCTGCCAAGCAG
CACACAGACTTCTACACGGTCCACACTGACGTCAATTCAG
AGGTGGATGCCCTGGACCCCAGTATAATGGACTTTGCCTG
GCAAGGAAACCTGTGGGAGGAGATGAAGGATGACAGCTTT
AACCTGGAAGCATTAGGGACTCTCAGTAACTCTCCACTTC
GGCTGTCCGACTGTGACCTGGACACCAGCAGCGTCACGCC
AGTGTCCAGTGCAGGAGGACTGCCTTACCCAGACCTGCAG
GTGACAGGCCTCTACTCTTCATACTCAGCTATTGATGCTC
TCTCTAACCAGTACATGAACACACAAGGAGGAACAAAACC
TATCGTTCTGCTTTAATTGCACTCACAGTAAATGAAGCAA
GCTGAGCTTTACTCCGCAAGACCATCTCTAAAGTCGTTCA
ATCCTGGCTTCCGTGGTGTGTCACGAAACTCCAAAACATA
TCCTAAAAACGCAAATTTCCTACAAGGCAGCCAAAAAGAA
AATAATTATAATTTTCCATAATCAGAGTATACGCTGAACT
GACATGAATGAACTTATGGTGGCATAAATTATAAAGACAT
TGAATGCATTATGTTAGTGAAGTATTTAGCGAGAGGGAGG
ATGATTTACAGTATATGTGGTGTAAGGATTTTTTCTATTA
CAGTCGGGTGTTGATTGCAATACTTGGATTGTGACCAAAA
TACAGTGTTGCTCTCATCATAAACCTAATGCAAATTGTGA
GTTTTAACACTAAAGGAACAAAGAAAAAAAAAATCAACAG
TAAAACATGACTATGGGTGTGTTGCCAAGCTTTTTTCCCC
ATGTACCATAAATAAAACTTTCCCCCTTTCTTTTGTCCAT
TTAACTGTTAGTCTTGTAATTGTAGCTGTGTGTATTTTTG
TTGTACTGTGATAGACACTGTATCTGCTCTTTAATGTTTG
TTTATTATTTATATTTATGAAAAGAGCTGAAATGGTGACA
TGAATCTTTGTTTATTGTACATATCGAAATATTTCAAATG
CAGGCAATAAAATTCACATTCAGATCAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations