Transcript

glra4b-201

ID
ZDB-TSCRIPT-090929-4307
Name
glra4b-201
Previous Names
  • glra4b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019116 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019116|OTTDARG00000015950|ZDB-GENE-020402-2 glra4b|OTTDARP00000016149 glra4b-001 LG_ BX470076.3 Danio rerio protein_coding KNOWN, 1926 bp
GCTGTGCTCAGTCAGATGGCAGTGGAGGAGAGACCAGAGT
GCATCAGAATGGGCGTCCTGCCCCTCAAAAACACATCTGC
TCATTGAGATTTAGCCACGGGACACCAGAAAAGCAGCTGC
TGAACAGTGAAAGGATGTTTTCTGTGATCTGGAGGATCCT
ACTGGAGCTCTTACTGGTTTGCTGGATGTTTGAAGGGGTC
ATCAGGTGTGTGTTTAGTAAGGAGCTGAAATCTCCCAGTG
TTAGGACGAAGCCCATGTCACCATCAGATTTTCTGGATAA
ATTAATGGGAAAGACATCTGGATATGATGCTCGAATAAGG
CCCAACTTTAAAGGTCCTCCTGTAAATGTCACCTGCAACA
TTTTCATCAACAGCTTTGGCTCGATCACAGAGACTACCAT
GGATTACCGGCTGAACGTTTTTCTACGGCAGCAGTGGAAT
GACCCACGACTAGCTTATAAAGAATACCCAGACGATTCCC
TGGATCTGGACCCATCCATGCTGGACTCCATCTGGAAGCC
AGACTTGTTCTTCGCCAATGAGAAAGGCGCCAACTTTCAT
GAGGTCACCACAGACAACAAGCTGCTGAGAATTTTCCAGA
ACGGAAACGTGCTGTATAGCATCAGACTCACGCTGATTCT
GTCGTGTCCTATGGATCTGAAGAATTTCCCAATGGACACT
CAGACCTGCACTATGCAGTTAGAGAGCTTTGGCTACACTA
TGAATGATCTGATATTTCAGTGGTTGGACGAAGGCCCGGT
GCAAGTAGCTGATGACCTTATGCTGCCCCAGTTTGTCCTC
AAAGAAGAGAAAGACTTGGGATACTGTACAAAGCACTACA
ACACTGGTAAGTTCACCTGTATAGAGGTGAAGTTTCATCT
GGAGAGGCAGATGGGTTATTACCTGATCCAGATGTACATT
CCCAGCCTTTTAACAGTGATCCTGTCATGGGTCTCTTTCT
GGATCAACATGGATGCCGCCCCGGCCCGAGTCGGGCTGGG
CATCACCACAGTTCTTACCATGACCACACAGAGCTCAGGT
TCTAGAGCATCACTGCCTAAGGTGTCCTATGTGAAGGCCA
TTGACATCTGGATGGCAGTGTGTCTGCTGTTCGTGTTTGC
TGCTTTGTTGGAGTACGCAGCGGTTAACTTCGTTTCAAGG
CAATATAAAGAATTCTTCCGACTGAGGAGGAAACTGCGGC
AGGAGCAACGCAACAGAGCTGCCTCTGGTCAAGCTGGAGC
AGCAGAAACGAAGAACAAGAGTAACAACGTCACAGGAGGC
ACACCGAGCAGAAACGCACAACGCCAGTGCAGCGCCTGCG
CACGGGAAGAGCAGTTGGCCTCACAGAATCAGGACTTGTA
CTTTCCGGGCTTTGGGATAGACACGAGTCTGTCTGGAGAC
GGGCCTCTCTCTGAAGCTGCTGCCATGTTTGCTGGTTTGC
CACCCGGTCATGCCCTGTTTGACATTCGCCGGCGCTTTGT
GGAACAAGCGAAACGGATCGACACCATCTCACGAGCCGTC
TTCCCCCTCAGCTTCCTCGTATTCAACGTGTTTTACTGGG
TCACTTATAAAGTGCTTCGAAACGAAGACATTCACCTTGC
ACTGCGACCCTGACACCCTTTAGGACTTCTGAACTTCCCG
TTATACCTTCTTGTGAACCAGTTTTGGTCCAGCGTGAGGA
TGAGCTCCTTTATCAAAGACATTTATAAAATCAAACCAGT
CTATGAAGCGGTGCAACAAGTTCTCTCTGCATGAGTGAGA
ATATATGCATGAGTCTGAGAGCACTTTAACAAAGAGCTAA
ATAAACCTTTAGCTTATATGAAGAACGGCTGATTCACTCC
TGACCTTTGCTCTTTTTTTGTTTTTGCACAGAGCACATTT
GTTCTTGTCCGTTGTAAAAAAAAATAAATGTTATATATGA
ATTTTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations