Transcript

atg16l2-201

ID
ZDB-TSCRIPT-090929-4147
Name
atg16l2-201
Previous Names
  • atg16l2-001
  • si:ch211-152c12.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000018658 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000018658|OTTDARG00000015569|ZDB-GENE-060503-197 atg16l2|OTTDARP00000015745 atg16l2-001 LG_ CR388135.16 Danio rerio protein_coding KNOWN, 1007 bp
CGCTTTCCACAATGGAAAACAGACACACGGGTTCAGGATG
ACGGCCATGAACTATGACTAGGAAACTGTACCGTTGTTAC
TGCGCTTTTTATTATTGTTTATGATCATGGCGGCGGCGAT
AAACTCTGAACCTAAACGCCAGAACGAAACATGGAAGCGT
CACATTATCAGACAGCTGAAAAACCGCAACAGGACACAGA
CGAGCCTCTTCCAGGACATTATACAGTCATATCACAGTCT
GCTGGAGAAGTCCAAGCAAAGAGCCCTCATAACCAAAGGC
ATTCTGGGATCAGGGTCAAGGACCTCACCAGTTCCCTCAT
CGGAAGATTCGCTGGCCTCCCTAAAGACCACCACCGGTGA
GCTTGCATACCAAGTGGTGGAACTGCAGCAGAGAGTCCAG
ATGAAGGAAGTGACGCTGGATGAACAGCATAACAAGTTGT
TTGAGGTTCAAAACCATCTTAGTATTATGACATTAGAACA
CAGCGAGCTTCAGGAACGCGTGACGGAGGTGCAGACTGGA
AACCGACTCCTCAAACAAAAATATGACTCTCTCCTGGAGC
AGCACCAGAATATGGAGAAAACATACCGGCAGGAGAAACT
CCACAGCGCAGACATCCTGGAGAACATGATCCGACCAAAG
CAGCAGGCTGCTGCCCGCATGAACCACCGCAATGAGAAGA
GAGTGAGAGCCAGAGAGGCCAGCATTCACAAAGAGCTTCA
GGAGGCTGCCAATAAGAATGTCAATATTAATGAAGAGTCT
GGAAATGTTTCACCTCCCAACCCGTCATCTCCTCAATGTG
AAACTGCAGAGAGGTTGGAAAGATCCCACGGGCCGCTGTT
CAGGTCTGCTTCAGCTACGTCTCCCCGCATCATCAGCTCC
ATCAGGGGTCTTTTTGAGAGGAAGATTCGAGGTAAATCAG
TTTGCCGGTCAGAAGAGGATCTCTATATACCATTAGGAGT
CTGTCTGGCTGCCAGAGTTCCAACCAAAGCGATTTCTTCA
CTGGTGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations