ZFIN ID: ZDB-TSCRIPT-090929-4101
Transcript Name: grn2-201
Previous Name: grn2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018502 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018502|OTTDARG00000015441|ZDB-GENE-050522-264 grn2|OTTDARP00000015624 grn2-001 LG_ BX510986.8 Danio rerio protein_coding KNOWN, 668 bp
CAGCAGAAGCATCCCGAACAGAAGGAAAACCAGCCAGAAA
GATGTTCCCAGTGTTGATGTTACTCATGGCGGCTCTGGTG
GCTGCAGATGAGCCTCTGCTGGATCTGTCCATTCCGATGG
AGACTGAAGACGTCTCTGCCTCTGTGATTCACTGCGATGC
TCGAACTGTGTGTCCAGATAGAACAACATGCTGTCGGACT
CCATATGGCAAATGGACATGTTGTCCATTCCCAATGGGTC
AGTGTTGCAGGGATGGGATTCACTGCTGTCGACACGGTTA
TCGTTGCAATTTCGCCTCCACCCGATGCCTGCGAGGCTGG
CTGTCACTGCCATCGTCCTTCCAGGAGGCCACCAGAACCT
TCGAGAAAGATCAGACCCAGGCTGAGACTGTCCAATGTGA
AGGAAATTTCTACTGCCCGGCTGAGAAGTTTTGCTGCAAG
ACTGGAACTGGCCAGTGGGGCTGCTGCAGCGAGTTGGAGT
TGTAAGCAAACAACCACTGTTACACTGGTTCACCTCTTAC
TGAAGACTGTCAAAATGCAAGAGGCTCCAAACTTCATTCA
TGTTTCAGGCTATAGTTTACTCTTACTGAATTAGTGTGAA
ATAAAAACTAAAAGAATTACTGTCAAAATGCACCGTCATT
TAATAAATCTTTGTGATTAGTGGGAAAA

grn2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA grn2-201 668
grn2-202 (1)    Ensembl 783
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
grn2-201 Contained in:
[BAC] CH211-173P18 (1)

Genome Resources: Vega_Trans:OTTDART00000018502 (1),  Ensembl_Trans:ENSDART00000051970 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC095576 (1) 749 nt
GenBank:EH470387 (1) 697 nt
GenBank:EH280261 (1) 354 nt
CITATIONS (2)