ZFIN ID: ZDB-TSCRIPT-090929-3976
Transcript Name: leo1-201
Previous Name: leo1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017989 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017989|OTTDARG00000015029|ZDB-GENE-040426-2435 leo1|OTTDARP00000015196 DKEY-7C4.1-001 LG_ CR848839.8 Danio rerio protein_coding KNOWN, 2284 bp
TATTTTTACAGCCTGTGAAAATGGCGGATATGGACGAACT
GTTCGGGAGCGATGGCGATAGCGACAATGAGCAACGAGAT
TCCGGCTCTGGTTCTGGCTCTGATTCGGATCATGAGAGAC
CAAGATCTGCCAGCAACGCTTCTGGAAGCGAGAGTGCTCA
GAGTGACCGAGATCATGATGATGATGAAGATGAAGATGGC
GGAAAGCCTAGCAATAAAGAGCTGTTTGGAGACGACAGTG
AAGATGAGCACGGCAGCCAGCACAGCGGGAGCCAGCACAG
CGGCAGCCGGCACAGCGGCAGCCGGCACAGCGGCAGCAGG
CACAGTGGCAGTAGGCACAGTGGCAGCCAGCACAGCGGGA
GCCAATCAGAGCGATCGGGCAACCAATCAGACGCCACCAT
GCACTCTGACAATGAACACAGCATGTCTGAGGCCCATCGT
GGTGAGCAGGATGATGAGGATGATGATGACAGAGGCCACA
GGTCAGACGTAGGCAGTCCAGCCTCAGGAGCAGGAAGCCG
CAGGTCGGACAGAGGAAGTGGAAGTCCAGGGTCAGAGGCG
GGAAGTCCACGCTCAGAAGCTGGAAGTGGTCATTCGGATC
CTGGAACCCCACATACAGATGGAGAGGGGTCAGGGAAAGA
TGCCCATTCTGGAGATGAGAAGTGGGGTGGAGATGGAAAA
AGTGACCAGTCGGAGGACGAGGACAAACAGCAGAACTCTG
ATGATGAGAGGGAGCGATCTGATGAAGAAGGGGAGAGGCA
GAAATCAGAGTCGATTAAGGGCAGTGACAGCGAGGATGAT
TTCACACGCAAGAAAAAGAAAAAGATTGCTTCGGACTCGG
ACTCAGACTCTGATGCTGAAACACAGGGTGGTAAGAAGCC
TGCAGCAAATGATCTTTTTGGGGAGGCAGATGATATTTCG
TCAGACAGCGATGCAGAGAAACCTCTCACACCTGGCCAAC
CATTGGATGCAGATGACGGAATGGAGGGAGATCAGCCTGA
GGAAGAGCCAGCTCCAGAGACGAGGATTGAAGTGGAGATA
CCTAAAGTCAGCACAGACCTGGGCAGCGATCTCTACTTCG
TCAAATTACCCAACTTTCTCAGTGTGGAGCCCAGGCCGTT
CGACCCTCAGTACTATGAGGATGAGTTTGAGGATGAGGAG
ATGTTAGACGAGGAAGGAAGAACTCGTCTAAAGCTAAAGG
TGGAGAACACCATCAGGTGGCGCTCTCGACGGGATGAGGA
GGGCAATGAAGTCAAGGAGAGCAATGCTAGGATTGTTAAA
TGGTCTGACGGCAGCATGTCTCTGCACCTGGGGAACGAAG
TGTTTGATGTGTATAAAGCTCCACTGCAGGGTGACCACAA
TCACCTGTTCATCCGCCAGGGCACAGGACTGCAGGGTCAG
GCTGTGTTCAAGACCAAACTCACCTTCAGACCTCACTCCA
CAGACAGCGCCACACACAGGAAGATGACGCTCTCTCTTGC
CGACCGCTGTTCAAAGACACAGAAGATCCGAATTTTGCCC
ATGGCTGGCAGAGACCCAGAGTCCCAGAGAAATGAGATGA
TCAAGAAAGAAGAGGAGAGGTTACGTGCGTCCATCAGGCG
CGAGTCCCAGCAGAGGCGCATGAGAGAGAAACAGCATCAA
CGAGGTCTGAACGCCGGCTACCTGGAGCCTGACCGCTACG
ATGAGGACGAAGAGGGTGAAGAGTCCATTAGCCTGGCTGC
AATCAAGAGCAAATATAAGGGTGGAGGAGGTCTAAGGGAG
GAACGAGCCAGGATCTATTCGTCAGACAGCGATGAAGGTT
CTGATGAAGACAAGGCCCAGCGACTGATGAAGGCCAAGAG
ACTGGACAGCGATGAGGAGGGAGAGAACTCTGGAAAGAGG
AAGGCAGAGGAAGATGAGGAATCTGCTTCAAAGAAGCCCA
AAAAGTATGTCATTAGTGATGAAGAAGACGAGGACGGAGA
TGGAGAACGCGATGGAGACCGAGAGAGAGGCGGGGATATG
GATGGAGACGGAGATGGAGATATGGAAGGAGATGGAGATG
TGGACAGAGACGGAGATATGGATGGAGATGGAGAAGGCGA
TGGAGAGGGAGACGGAGAGGAAGACGAGTAATTTTTTTTT
TCTTAATTTTTTTTTTTTTTACATTAATGTTTTGATCGGC
TAATTGTTGGTTAAGTACGTGTTTAGTCCAGAAAATCAAT
TGTGCAGTTAACTGATTGTATATTTTATAATGTCAGAAGA
TGTTCATCATTCAACAGGTTAATAAAGAGCAATAACCTCA
GTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
leo1-201 Contained in:
OTHER leo1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000017989 (1)
  • Ensembl_Trans:ENSDART00000077694 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC066443 (1) 2323bp
    GenBank:CN180372 (1) 814bp
    CITATIONS (2)