ZFIN ID: ZDB-TSCRIPT-090929-3956
Transcript Name: znf296-002
Previous Name: si:dkey-7l12.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017939 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017939|OTTDARG00000013317|ZDB-GENE-050419-201 znf296|no_translation DKEY-7L12.1-002 LG_ BX927074.16 Danio rerio protein_coding NOVEL, 650 bp
AGCTGTTGAAACAGGAAAGGTGACATTTTTGAGTAACCAC
CAGTAAAATCCTCCCCTCCCCGGGACTGTCTGTACCTGCA
TCGGCATGGACAGCCTAGTCCGGGCAGGTGGATCCAGTAG
AGGCTGTAAGGTGTGTGTTTGTATTTGCGTGTGTGATCAG
GAGTCCATGACCACAGCAGAAGCACCCAGGCCAAAGGGTT
AGAAATGCTGGTTTGAATTCTACATGGAGCAGGACCTTTG
GGGTCACATTGGTGCCGTGACCCAGATTGAATTGAACTGT
GCAAGTTAGCTCTTTCTTCGGCTCTAGATGCACTAGCAAC
TAGATGATCCAAATTCCACACTCATCACCTCCTCATCATC
ATCTGAGCAGATACCTGAGCCTGAAGATGAAGGTCGCGAC
CTGTTGACATGTGGCCAGTGTGGTCAGGCGTTCCCGCTGG
CCCACATCCTCAACTTTATCCAGCACAAACAGGGCGGGTG
CGGCACAGCCAGAGCCCGTCCTCAGGGCCACACTCCTCCC
TCTCCAGCCAGCCGGACGGTGCAGTGCAGCCAAGGAACGA
AGGTGGAGGCGGGTTATGTGGAGCTCCGGCGGGTGACGGA
CAGGAGATGGAAGGAAGAGCCAGGTGTGAGGGTGGAGGCC
AACCGAGCTG

znf296 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA znf296-201 (1)    Ensembl 3581
ncRNA znf296-002 650
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znf296-002 Contained in:
[BAC] DKEY-7L12 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000017939 (1),  Ensembl_Trans:ENSDART00000125657 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK237177 (1) 749 nt
CITATIONS (2)