Transcript

znf296-002

ID
ZDB-TSCRIPT-090929-3956
Name
znf296-002
Previous Names
  • si:dkey-7l12.1-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000017939 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017939|OTTDARG00000013317|ZDB-GENE-050419-201 znf296|no_translation DKEY-7L12.1-002 LG_ BX927074.16 Danio rerio protein_coding NOVEL, 650 bp
AGCTGTTGAAACAGGAAAGGTGACATTTTTGAGTAACCAC
CAGTAAAATCCTCCCCTCCCCGGGACTGTCTGTACCTGCA
TCGGCATGGACAGCCTAGTCCGGGCAGGTGGATCCAGTAG
AGGCTGTAAGGTGTGTGTTTGTATTTGCGTGTGTGATCAG
GAGTCCATGACCACAGCAGAAGCACCCAGGCCAAAGGGTT
AGAAATGCTGGTTTGAATTCTACATGGAGCAGGACCTTTG
GGGTCACATTGGTGCCGTGACCCAGATTGAATTGAACTGT
GCAAGTTAGCTCTTTCTTCGGCTCTAGATGCACTAGCAAC
TAGATGATCCAAATTCCACACTCATCACCTCCTCATCATC
ATCTGAGCAGATACCTGAGCCTGAAGATGAAGGTCGCGAC
CTGTTGACATGTGGCCAGTGTGGTCAGGCGTTCCCGCTGG
CCCACATCCTCAACTTTATCCAGCACAAACAGGGCGGGTG
CGGCACAGCCAGAGCCCGTCCTCAGGGCCACACTCCTCCC
TCTCCAGCCAGCCGGACGGTGCAGTGCAGCCAAGGAACGA
AGGTGGAGGCGGGTTATGTGGAGCTCCGGCGGGTGACGGA
CAGGAGATGGAAGGAAGAGCCAGGTGTGAGGGTGGAGGCC
AACCGAGCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations