Transcript

znf296-201

ID
ZDB-TSCRIPT-090929-3199
Name
znf296-201
Previous Names
  • znf296-001
  • si:dkey-7l12.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000015804 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000015804|OTTDARG00000013317|ZDB-GENE-050419-201 znf296|OTTDARP00000013423 DKEY-7L12.1-001 LG_ BX927074.16 Danio rerio protein_coding NOVEL, 3581 bp
GACGGGCACAGCACTGAACGACACTCAAGACGCACATCAC
TGCCGTTTTATGAGGTCTACTAGGTTTGCCTGCTTAATTC
TGGTGTAGTTTTGGAGGAGCCTCTCTCGCTATGTCCAGAC
GCAAACTCGGCAGCAGACCGCAACACCTGAGTGTGATGCA
AGATGATCCAAATTCCACACTCATCACCTCCTCATCATCA
TCTGAGCAGATACCTGAGCCTGAAGATGAAGGTCGCGACC
TGTTGACATGTGGCCAGTGTGGTCAGGCGTTCCCGCTGGC
CCACATCCTCAACTTTATCCAGCACAAACAGGGCGGGTGC
GGCACAGCCAGAGCCCGTCCTCAGGGCCACACTCCTCCCT
CTCCAGCCAGCCGGACGGTGCAGTGCAGCCAAGGAACGAA
GGTGGAGGCGGGTTATGTGGAGCTCCGGCGGGTGACGGAC
AGGAGATGGAAGGAAGAGCCAGGTGTGAGGGTGGAGGCCA
ACCGAGCTGAAGAGCCCTCCGTGTTCACCTGCCAGGTGTG
TCAGTGTGTGTTTTCCAGCGCATGGAATCTCCTCCAACAT
GCTCAGATCACACATTCCCTCAACATCTACCAGGAGGACG
ACACCCCCACACAGACGTCAAAACCGGCAGCCATGATGGA
TCCACGGCATCTGGGTGCTGCACTGGCCACTGCTTTCCAA
CCATCTTCCCTGCGATCAGCACGCCCTCACAAGCCTCCTC
CCAGCTCCACCCATGTACCACGTGACCTGCAGGGCTTGAA
CTTCTCCATGTGTTTGCAGCGCCTGGCAGAGGTCAGTTGC
AGCAGCGGCGGAGTGGTACCTTCTCCTTCCCCATCTCCTC
CAGCCGCTTCACCTTTTCCCCACTCCACTCCATCAATTCA
CACAGCCTTCTCCTGTGAGATGTGCGGCCAGGGCTTTCAG
TCTTTGCGCAGCCTGTCTGCCCACCGCCGCACTCACGCCT
GCGATAGGCCCTACCACTGCGGCCTGTGCCAGCTTACGTT
CTCCCAGAGTGGCGAACTGGCACGACACATGAGGAGCCAC
CGCCGTTCTGCTGCTGGACAGGAAACATCTGATCCAAGCC
CTGCGAGTGCAGATGAGGACAGAAAGCTTTCTGGACCGGG
AGATAATGATATTTCTGGTGGTCACGGAGGAAGCTTGGAG
GCTGGGAAGCATCCAGGAGGTGCCAGTCTGATCTTGATGC
CCTTGCAGACTAGAGCTGCGGATCGCAATCTTCTGCGCTA
CTACCAGAGAGAAGTGGAGGAGGAGGTTCAGGGTGAGCCA
CAGCAGCCATCTCCCTACGGCAGCCCCTCAGAGGGCTCTC
TGGAGAGCGGAGATACAGGTGGAAGCGGGGAAAGTGGAAT
CGCCAGCGGCAACTGCACACCAAAGCGTCCAGAACGGGAA
GATCGTCCTCAAGGCGACTGGGAGCAAGAGGTTGAGGCTG
TAGAGATTGTTCAGGACTGGCAACGGGAGAACGAAAGGAG
GCAGGTCACCAATGGAATGGGCAAAAAGAAAAAAGAAGAA
GCTTGCGAGTTTTGTGGAAAGTGTTTCCGCAACAGCAGCA
ACCTGACGGTCCACCGGCGCAGCCACACAGGGGAACGGCC
ATACCGCTGCGGCCTCTGCAGCTATGCCTGTGCACAAAGC
AGCAAGCTCACACGACACATGAAGACTCATGGCGCCCGTG
GGACACGTGCTCCCTTTCAGTGCCAGCTTTGCTCCGTACC
GTTCACTGTCTATGCTACACTGGAGAAACACCTCAAGAAG
GTTCATGGACTTACTCATGCCAGTGTCGGCACCTACAGCC
AGAGCTCACTCACTGAGTATAACAGCCTCGGCATCAAATT
AGAGGACGAATCCATCAGTGATCAATCAGGAGCTCCCATC
ACAATGCTCGCAGATTCCAGTGTGGACCAAACAGAGCAGC
TCAAAGAAGAGGACACTGAGATGAGGGTCAGCAGCACAGA
TGAGCCACCTATCTCTGAGAAAATGGGCACCACTGCGGCA
CTCAGTCAAACCACAATTTAAAATTAGCAGCACTTCTGCA
CATGACACTCTGATCATGTCCAAAACCACCATACGTGACG
ATGTTATGCCCATGACTCAGTATGAGCATCTTATCAAAAA
ACCAAGAAGACCTTTCCTGTCTTCACCACAGTACTTACAG
ACACTCTAGGGTGCAACGCCGATTACTGACCAAGACTTTG
ATTCATATCAGTAAAAGTGCCTACTGTTAAATCTAGTATC
AGATGACTTCTAAATCTTACCCAACCACCATGGCAAGGCA
CTTTGAACCCAGAATAAAAACCTGCAACTCGTAGTGCACA
ATCAGAGTATATAGAGATGGTTGTAAGTCATTTTAGCCTT
TTGATGAGCCCTAAAGACAATCGAACAGGAAGACTGAGCA
GCCTACAAGTGATCTGTCAATGTGATTTAAAATTACACAA
TTCAACTCTGAAGTGGATACCTTGAGTTTACGCTTTTGTA
GCACTCTACCGCAGAGCCTTAAAGGTTCTTAAAAATAGGA
TATGGTGTACAGTCCTGCTCCCGAAGAGTCTTGCACCATT
TGGCTTCAACGTTGATTAAACTAATCAAGGACTTTTTCAA
AAATAACTTCATCAAGGTGTCGGAGCAGGTTTCGGATGAA
CTCTACCACACCATGGTCTTCCAGGAGCAGGATTGGACAT
CTCTGGTCTACTTAAGAATATATCTTAAGGAGCCAATGGG
CCGCTTGTGTTTCCCAAAATATCTGACAGGGTTGATTCCT
TTTGATGCTGTATATTAAAAAGGACTGATTGGGTCTGTGG
CAATACATGTTCACTGTCACTTATCTATGTTAAAGAACCT
TTGTTTCACATTTAGTAAATAGTGTAAATATATCCCGACA
CACTGTCATTTTGTAACCCATTCCACCAAAATGTCACATT
GTTTTTTTTTTATAGCAAGACTACTGCACAACAGAATCCT
TTTCGCTGTATTTTGTGAGCCTGTTTAGTCTGTTTACAGA
CCTTTGTTTTACTGCCAGAAAACATGGAAAAGCTATCAAA
TGTTTTCTTTATTTTTGTTCAGTGGTTTTCCAGGTTGTTT
GTTGTGGTCATGTGAATGAAAAGCTTCATTTCTGAGGAAA
GACTAAGTAGTCAATGACAGCTTTGACCTTTCTGAACGGT
GGACCCACTGAGAGAGCACTTGTGTGTTTGTTCATATGTG
ATAAAGATACCAGATTTACGATAAATCTATACAGGGAAAG
ATTGCTTCGTTACAATTGCTTTGTTTATCAATGTCAGGGA
ACTGTTATGTTACAGTTTATATTTGTGATATGACAAATAA
TGTAGAATAAGTAATAAAAGGGAATAATAAAGCAATTTTT
GTATTAACAAATGTGAAAATAGTTGGGCATTCAATGATGT
CCATTTCTTCAGGGAGCAGCGAAAACAAAGCTCTTTTTGT
CCTCTATATATTGTTATATCAGTTTCTGTTGGTTTAAATT
TAATGTCTTGCGTTATTTCTCACTGTGTAGTCCACAACTT
TACTGTGTATTTTGTATCCCAATGCCTATTTGTATGACAA
TTAAAAAAAACAGATTCAAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations