ZFIN ID: ZDB-TSCRIPT-090929-3199
Transcript Name: znf296-201
Previous Names: znf296-001, si:dkey-7l12.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000015804 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000015804|OTTDARG00000013317|ZDB-GENE-050419-201 znf296|OTTDARP00000013423 DKEY-7L12.1-001 LG_ BX927074.16 Danio rerio protein_coding NOVEL, 3581 bp
GACGGGCACAGCACTGAACGACACTCAAGACGCACATCAC
TGCCGTTTTATGAGGTCTACTAGGTTTGCCTGCTTAATTC
TGGTGTAGTTTTGGAGGAGCCTCTCTCGCTATGTCCAGAC
GCAAACTCGGCAGCAGACCGCAACACCTGAGTGTGATGCA
AGATGATCCAAATTCCACACTCATCACCTCCTCATCATCA
TCTGAGCAGATACCTGAGCCTGAAGATGAAGGTCGCGACC
TGTTGACATGTGGCCAGTGTGGTCAGGCGTTCCCGCTGGC
CCACATCCTCAACTTTATCCAGCACAAACAGGGCGGGTGC
GGCACAGCCAGAGCCCGTCCTCAGGGCCACACTCCTCCCT
CTCCAGCCAGCCGGACGGTGCAGTGCAGCCAAGGAACGAA
GGTGGAGGCGGGTTATGTGGAGCTCCGGCGGGTGACGGAC
AGGAGATGGAAGGAAGAGCCAGGTGTGAGGGTGGAGGCCA
ACCGAGCTGAAGAGCCCTCCGTGTTCACCTGCCAGGTGTG
TCAGTGTGTGTTTTCCAGCGCATGGAATCTCCTCCAACAT
GCTCAGATCACACATTCCCTCAACATCTACCAGGAGGACG
ACACCCCCACACAGACGTCAAAACCGGCAGCCATGATGGA
TCCACGGCATCTGGGTGCTGCACTGGCCACTGCTTTCCAA
CCATCTTCCCTGCGATCAGCACGCCCTCACAAGCCTCCTC
CCAGCTCCACCCATGTACCACGTGACCTGCAGGGCTTGAA
CTTCTCCATGTGTTTGCAGCGCCTGGCAGAGGTCAGTTGC
AGCAGCGGCGGAGTGGTACCTTCTCCTTCCCCATCTCCTC
CAGCCGCTTCACCTTTTCCCCACTCCACTCCATCAATTCA
CACAGCCTTCTCCTGTGAGATGTGCGGCCAGGGCTTTCAG
TCTTTGCGCAGCCTGTCTGCCCACCGCCGCACTCACGCCT
GCGATAGGCCCTACCACTGCGGCCTGTGCCAGCTTACGTT
CTCCCAGAGTGGCGAACTGGCACGACACATGAGGAGCCAC
CGCCGTTCTGCTGCTGGACAGGAAACATCTGATCCAAGCC
CTGCGAGTGCAGATGAGGACAGAAAGCTTTCTGGACCGGG
AGATAATGATATTTCTGGTGGTCACGGAGGAAGCTTGGAG
GCTGGGAAGCATCCAGGAGGTGCCAGTCTGATCTTGATGC
CCTTGCAGACTAGAGCTGCGGATCGCAATCTTCTGCGCTA
CTACCAGAGAGAAGTGGAGGAGGAGGTTCAGGGTGAGCCA
CAGCAGCCATCTCCCTACGGCAGCCCCTCAGAGGGCTCTC
TGGAGAGCGGAGATACAGGTGGAAGCGGGGAAAGTGGAAT
CGCCAGCGGCAACTGCACACCAAAGCGTCCAGAACGGGAA
GATCGTCCTCAAGGCGACTGGGAGCAAGAGGTTGAGGCTG
TAGAGATTGTTCAGGACTGGCAACGGGAGAACGAAAGGAG
GCAGGTCACCAATGGAATGGGCAAAAAGAAAAAAGAAGAA
GCTTGCGAGTTTTGTGGAAAGTGTTTCCGCAACAGCAGCA
ACCTGACGGTCCACCGGCGCAGCCACACAGGGGAACGGCC
ATACCGCTGCGGCCTCTGCAGCTATGCCTGTGCACAAAGC
AGCAAGCTCACACGACACATGAAGACTCATGGCGCCCGTG
GGACACGTGCTCCCTTTCAGTGCCAGCTTTGCTCCGTACC
GTTCACTGTCTATGCTACACTGGAGAAACACCTCAAGAAG
GTTCATGGACTTACTCATGCCAGTGTCGGCACCTACAGCC
AGAGCTCACTCACTGAGTATAACAGCCTCGGCATCAAATT
AGAGGACGAATCCATCAGTGATCAATCAGGAGCTCCCATC
ACAATGCTCGCAGATTCCAGTGTGGACCAAACAGAGCAGC
TCAAAGAAGAGGACACTGAGATGAGGGTCAGCAGCACAGA
TGAGCCACCTATCTCTGAGAAAATGGGCACCACTGCGGCA
CTCAGTCAAACCACAATTTAAAATTAGCAGCACTTCTGCA
CATGACACTCTGATCATGTCCAAAACCACCATACGTGACG
ATGTTATGCCCATGACTCAGTATGAGCATCTTATCAAAAA
ACCAAGAAGACCTTTCCTGTCTTCACCACAGTACTTACAG
ACACTCTAGGGTGCAACGCCGATTACTGACCAAGACTTTG
ATTCATATCAGTAAAAGTGCCTACTGTTAAATCTAGTATC
AGATGACTTCTAAATCTTACCCAACCACCATGGCAAGGCA
CTTTGAACCCAGAATAAAAACCTGCAACTCGTAGTGCACA
ATCAGAGTATATAGAGATGGTTGTAAGTCATTTTAGCCTT
TTGATGAGCCCTAAAGACAATCGAACAGGAAGACTGAGCA
GCCTACAAGTGATCTGTCAATGTGATTTAAAATTACACAA
TTCAACTCTGAAGTGGATACCTTGAGTTTACGCTTTTGTA
GCACTCTACCGCAGAGCCTTAAAGGTTCTTAAAAATAGGA
TATGGTGTACAGTCCTGCTCCCGAAGAGTCTTGCACCATT
TGGCTTCAACGTTGATTAAACTAATCAAGGACTTTTTCAA
AAATAACTTCATCAAGGTGTCGGAGCAGGTTTCGGATGAA
CTCTACCACACCATGGTCTTCCAGGAGCAGGATTGGACAT
CTCTGGTCTACTTAAGAATATATCTTAAGGAGCCAATGGG
CCGCTTGTGTTTCCCAAAATATCTGACAGGGTTGATTCCT
TTTGATGCTGTATATTAAAAAGGACTGATTGGGTCTGTGG
CAATACATGTTCACTGTCACTTATCTATGTTAAAGAACCT
TTGTTTCACATTTAGTAAATAGTGTAAATATATCCCGACA
CACTGTCATTTTGTAACCCATTCCACCAAAATGTCACATT
GTTTTTTTTTTATAGCAAGACTACTGCACAACAGAATCCT
TTTCGCTGTATTTTGTGAGCCTGTTTAGTCTGTTTACAGA
CCTTTGTTTTACTGCCAGAAAACATGGAAAAGCTATCAAA
TGTTTTCTTTATTTTTGTTCAGTGGTTTTCCAGGTTGTTT
GTTGTGGTCATGTGAATGAAAAGCTTCATTTCTGAGGAAA
GACTAAGTAGTCAATGACAGCTTTGACCTTTCTGAACGGT
GGACCCACTGAGAGAGCACTTGTGTGTTTGTTCATATGTG
ATAAAGATACCAGATTTACGATAAATCTATACAGGGAAAG
ATTGCTTCGTTACAATTGCTTTGTTTATCAATGTCAGGGA
ACTGTTATGTTACAGTTTATATTTGTGATATGACAAATAA
TGTAGAATAAGTAATAAAAGGGAATAATAAAGCAATTTTT
GTATTAACAAATGTGAAAATAGTTGGGCATTCAATGATGT
CCATTTCTTCAGGGAGCAGCGAAAACAAAGCTCTTTTTGT
CCTCTATATATTGTTATATCAGTTTCTGTTGGTTTAAATT
TAATGTCTTGCGTTATTTCTCACTGTGTAGTCCACAACTT
TACTGTGTATTTTGTATCCCAATGCCTATTTGTATGACAA
TTAAAAAAAACAGATTCAAAG

znf296 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA znf296-201 3581
ncRNA znf296-002 (1)    Ensembl 650
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
znf296-201 Contained in:
[BAC] DKEY-7L12 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000015804 (1),  Ensembl_Trans:ENSDART00000098980 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN014527 (1) 810 nt
GenBank:CN504968 (1) 790 nt
GenBank:CD594218 (1) 650 nt
GenBank:AF160650 (1) 637 nt
GenBank:AF160640 (1) 499 nt
CITATIONS (2)