header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3954
Transcript Name: exosc5-201
Previous Name: exosc5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017937 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017937|OTTDARG00000014987|ZDB-GENE-060503-675 exosc5|OTTDARP00000015153 CH211-194N6.2-001 LG_ BX649594.7 Danio rerio protein_coding NOVEL, 705 bp
GAGCAGATTGTGCATGAGGACCGAGATGGAGCTGGAGCGA
AGTTGTCCAGTTTTAAGAGAATATGGAAGTGAACAGAGTT
TGTTATCAAGACCTGACGGGTCGTCCACGTTTGTACAAGG
GGACACGAGTATCCTGGCTGGAGTTTATGGACCAGCTGAG
GTTAAAGTCAGCAAGGAAATATATGATCGGGCAACTGTAG
AGGTCCTTATACAGCCCAAAATGGGGCTTCCAAGTGTCCG
CGAGCGAGCGAGAGAGCAGTGTGTCCGTGAGACTTGTGAA
GCTGCCCTTCTGTTGACCCTTCATCCACGCTCTTCTCTCA
CGGTCATCCTGCAGGTCGTCCACGATGATGGATCTCTGCT
GTCGTGTTGTCTAAACGCTGCCTGTATGGCTCTAATGGAT
GCCGGGCTGCCCATGAGCCGCCTTTTCTGTAGTGTGACCT
GCGCCATTAGCAAAGAGGGCCAGATAATCACTGACCCCAC
AGCTCGACAGGAAAAGGAAAGTCGAGCGCTGTTAACATTT
GCCATTGATAGCAATGAGCGCAATGTTTTGATGTCATCGA
CTACAGGCTCTTTTTCAGTGCAGGAGCTCCAGCAGTGCAT
CGCTATCAGTCAGAAGGCCTCGGAGCAAATCTTCCAGTTT
TATAGGGATTCTGTCAAGCGGCGATATTCAAAGATGCAAT
AAAATATGCGTTGGGATTTTTTTTA

exosc5 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA exosc5-201 705
exosc5-202 (1) 486
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
exosc5-201 Contained in:
OTHER exosc5-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000017937 (1)
  • Ensembl_Trans:ENSDART00000059352 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK360480 (1) 755bp
    GenBank:BQ078764 (1) 623bp
    GenBank:BM860267 (1) 576bp
    CITATIONS (2)