ZFIN ID: ZDB-TSCRIPT-090929-3925
Transcript Name: gtf2h4-204
Previous Name: gtf2h4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017843 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017843|OTTDARG00000014918|ZDB-GENE-030131-6779 gtf2h4|OTTDARP00000015083 gtf2h4-001 LG_ BX537309.10 Danio rerio protein_coding KNOWN, 1892 bp
CGCGTGAGCCAATCAGCCTTTATGTTTCAGCGATCACGTG
ATCGTACAACATGGCTTCACACTGTCCGAGCTGAATGGCT
AGATGACTGTTCATGAAGAAGTACAATGATGTGTATCACT
TTATGCACTATTTAGTGCTTCCTAGCGCCTGTGAAACAAG
ATGAAGCTTCGCGTTCAGCTTCAGTGTAAGAACTTGCACG
AGTATCTGAAAGAACTGACCCCAGAAATCCTCGACAGGCT
CTACAATCACCCAGCAACATGTCTAGCAGTATACAGGGAA
CTTCCACCACTGGCAAAGAATTACGTGATGCGCATGCTGT
TTTTAGACCATCCACTCCCCCAGGCTGCGGTAGCCCTGTG
GGTTAAAAAAGACAGTCAAAAAGACCATGATCAATGTGTG
TCGGTGTTAACTGGGCTACGGCTCTGGCACAGTCAGCATC
TTCAAGGTGGACTTCAAGGTTTCGTGCTCAACCCCGTGTT
TAAGGACAACCTGAGAATAGCACTTTTAGGCGGTGGTAAA
CCGTGGGCAGACGAGGGTGCCAATCTGGGTCCCGATCGGC
ATGCGAGGGATGTAGAGAGTCTGGACCGCTATGCTATGGA
GCGCTGGGAGGTCATCCTTCACTTCATGGTGGGCTCTCCT
AGCGCAGCTGTCAGTCAGGATCTGGCTCAGCTCCTCATAC
AGGCCGGGCTCATGAAGAGCGAGACTGGTGAGGCTCCATG
CATCACATCAGCAGGGTTTCAGTTCCTGCTGCTGGACACG
GCATCTCAGTTGTGGTACTTCACCCTGCAGTACCTCAAAA
CAGCACAGTCGAGAGGAATGGACCTGGTGGAGATTCTTTC
CTTTTTGTTCCAGCTGAGTTTTTCCACTCTTGGAAGGGAT
TATTCTGTGGAGGGCATGAGCGAGTCCCTGCTCACATTTT
TGCAGCATCTACGAGAGTTTGGTCTGGTTTTTCAAAGAAA
GAGGAAGTCAAGAAGGTACTACCCTACGAGACTCGCCATA
ACTCTCGCTGCAGGAGTCACTGCAAACCCAGCCTCGGGAT
CTGCCTCTTCTGCACTGGGAGCAATACCAGGAACAGGAGA
CACTGGATTCATCGTTGTAGAAACTAATTATCGCATATAT
GCCTATACAAACTCTGAACTTCAGATTGCACTGGTCGCTC
TGTTTAGTGAGATGTTGTATCGGTTTCCTAACCTGGTGGT
TGCACAGGTCACCCGAGAGTCTGTGCAGCAGGCCATCAGT
AACGGCATCACCGCACAGCAGATTATTCACTTCTTACGGA
CCCGAGCACACCCAGTAATGCTTAAACAGACCCCCGTTCT
CCCCCCAACCATCACAGATCAGATCAGACTGTGGGAGCTT
GAGAAAGATCGCTTGCAGTTTACCGAGGGAGTGTTATACA
ACCAGTTTTTATCCCAGGCTGATTTCGAAGTGTTGCGGGA
CAGGGCTCAGGGTTTAGGAGTGCTGGTGTGGCAGAATCCC
GCTCACAGGGTCATGGTGGTGACTCCTCATGGACACAGCG
AGGTTAAGAGATTCTGGAAGAGACAAAAAAGCCATTCATA
AGGGAAAAACTTAAAGTATGCAGTAAGAAACCTAGTAAAC
AGTAGGTTCATGTAATCTTTTAGCTCTGAAAGATTACATA
AACTTACTGTATACTTATTATTGAATTTATGCTTACAAAT
GAACAGGAGGACTATTTTTGTGCATTTTACTGCAAGTTGA
TCTGGGTAAAAAAAACAAAGTTTCTATGCATAGTTTGAAG
CCTTTTGCTGTTCATGTGACAGTATGTGCATTATTATTCT
GTTATTGACTTGATTTCGCTTTTGTAGTGTATAAATTTGC
TACACGTTTGTGTCCAAGGTAAACTGACCAAAATAAACAC
TGTTTACAATGA

gtf2h4 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA gtf2h4-002 (1) 677
mRNA gtf2h4-204 1892
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gtf2h4-204 Contained in:
OTHER gtf2h4-204 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000017843 (1)
  • Ensembl_Trans:ENSDART00000052359 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC064301 (1) 1851bp
    GenBank:EG571308 (1) 920bp
    GenBank:EH451204 (1) 851bp
    GenBank:DY556517 (1) 725bp
    CITATIONS (2)