ZFIN ID: ZDB-TSCRIPT-090929-3926
Transcript Name: gtf2h4-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017844 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017844|OTTDARG00000014918|ZDB-GENE-030131-6779 gtf2h4|no_translation gtf2h4-002 LG_ BX537309.10 Danio rerio protein_coding KNOWN, 677 bp
ACAACATGGCTTCACACTGTCCGAGCTGAATGGCTAGATG
ACTGTTCATGAAGAAGTACAATGATGTGTATCACTTTATG
CACTATTTAGTGCTTCCTAGCGCCTGTGAAACAAGATGAA
GCTTCGCGTTCAGCTTCAGTGTAAGAACTTGCACGAGTAT
CTGAAAGAACTGACCCCAGAAATCCTCGACAGGCTCTACA
ATCACCCAGCAACATGTCTAGCAGTATACAGGTCCTTCTG
TTATACACGCATTCATATTTACGTGTACACTCATAATGTT
TTGCCTCTTGTTTAAACTGCTTATTTAAAATAAGCTGAGA
CAACTCGTTTCTTTAGATTTCTTTGGGAGAACCTAATTAT
ATTAAGTTAATGTATACTCAAATTTGTTAAGCCAACTTAA
TTGATGTACGTTGTGACAACACGAATGAATTGTGTGGAAC
TTTATTTTGATCTGATTAGATCACATACTGTTCAAGCAAG
TGGAGTTTATTTGGAAATAAAAAGCACAAATATTTTAGTA
AACAGCAGTTCTTGCTTTGCTGTAAAAAGGACTTTTAAAA
ATGATACTTTCAATGAAATTTTTGTTAGTTTTTTTTTTAT
TTTACATCACAATAGTTTATAAATTAATATTTTAAAATTA
TATTTTCTAGGGGATGTAATGGTGCAAAATTATATTT

gtf2h4 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA gtf2h4-002 677
mRNA gtf2h4-204 (1) 1892
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gtf2h4-002 Contained in:
OTHER gtf2h4-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000017844 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK683319 (1) 663bp
    GenBank:CT686427 (1) 315bp
    CITATIONS (1)