Transcript

slc17a8-201

ID
ZDB-TSCRIPT-090929-3861
Name
slc17a8-201
Previous Names
  • slc17a8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000017661 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017661|OTTDARG00000014769|ZDB-GENE-060503-416 slc17a8|OTTDARP00000014933 CH211-264E16.4-001 LG_ CR536616.8 Danio rerio protein_coding NOVEL, 1773 bp
ATGCCACTGGGGGGGTTTGCGGGTCTGAAGGAAAAGCTCA
ACCCGGGGAAGGAGGAGCTGAAGAATAATGTGGGCGACTC
TCTGGGGAACCTGCAGAAGAAGATCGATGGCTCAAATGTG
ACCGAAGAGGACAACATTGAGTTGACAGAAGATGGTCGGC
CGGTGGCAGCCCCTAAACGAAGCCCACCCCTATTGGACTG
TGGGTGCTTTGGCCTTCCCAAACGGTACATCATCGCCATG
CTCAGTGGACTGGGCTTTTGCATCTCGTTTGGCATTCGCT
GTAACCTTGGTGTAGCCATTGTGGAGATGGTTAACAACAA
CACAGTCTACATCAACGGGACGGCCGTCATGCAGCCAGCT
CAGTTTAATTGGGATCCAGAGACAGTGGGATTAATACATG
GCTCTTTTTTCTGGGGCTACATCGTCACTCAAATCCCTGG
AGGTTTCATCTCTAATAAACTAGCGGCTAACAGGGTGTTT
GGAGCAGCCATTTTCTTGACGTCAGTGCTAAACATGTTTA
TTCCATCAGCTGCCAGGGTTCACTATGGTTGTGTGATGTT
TGTGCGAATCTTACAAGGACTTGTGGAGGGTGTCACATAT
CCAGCCTGCCATGGGATGTGGAGTAAATGGGCTCCTCCGC
TTGAAAGAAGTCGTCTGGCTACTACCTCGTTCTGTGGATC
TTATGCAGGAGCTGTGATAGCCATGCCACTGGCTGGAATA
TTAGTGCAGTATGTGGGCTGGCCCTCTGTCTTCTATATAT
ATGGTGTGTTTGGCATTATATGGTATATTTTCTGGATCCT
GCTTGCTTATAACAGCCCAGCAGTACATCCCACCATCAGT
GAGGAGGAACGAAACTACATAGAAACCTCTATTGGGGAAG
GAGCCAATTTAATGAGTTCAACAGAGAAATTTAAAACTCC
CTGGCGTGAATTCTTCACTTCTATGCCCGTCTATGCCATC
ATTGTAGCAAACTTCTGCCGAAGCTGGACCTTTTACCTCC
TGCTCATTAGTCAACCGGCTTACTTTGAAGAGGTCTTCGG
GTTCCCCATTAGCAAGGTGGGCATTTTGTCAGCGGTGCCG
CACATGGTGATGACCATCATTGTGCCAATAGGAGGCCAGC
TGGCTGACTTCCTGAGGAGTCGGAAAATCCTCTCTACTAC
AACTGTGAGGAAAATCATGAACTGTGGAGGTTTTGGAATG
GAGGCCACGTTGCTGTTGGTAGTGGGCTTTTCACACACTC
GCGCAGTGGCCATCTCTTTCCTCATCCTGGCAGTGGGCTT
CAGTGGATTTGCCATATCAGGATTCAACGTAAACCATCTG
GATATAGCTCCTCGCTATGCTAGTATTCTTATGGGCATCT
CTAATGGAGTGGGCACCCTCTCTGGCATGGTTTGCCCCCT
CATCGTTGGTGCACTGACCAAACATAAGACTCGCCTGGAG
TGGCAGCATGTCTTCGTGATCGCCTCCATGGTGCATTACA
CTGGAGTCATTTTCTACGCTATCTTTGCGTCTGGAGAGAA
GCAGGACTGGGCTGATCCAGAGAACACGAGTGATGAGAAG
TGCGGCATCATTGGTGAAGATGAGCTTGCAGATGAAACTG
AACCCAGCAGCGACAGCGGATTGGCAACCAGACAGAAGAC
CTATGGAACCACAGACAACTCATCAGGCCGCAAACAAGGC
TGGAAGAAAAAGAGAGGGGTGACCATGCAGGCTGAAGACG
ATCACGAATCAAATCATTATGAAAATGGGGAATATCAGAC
CCAGTATCAATGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations