ZFIN ID: ZDB-TSCRIPT-090929-38
Transcript Name: adam8a-201
Previous Name: adam8a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002026 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002026|OTTDARG00000001898|ZDB-GENE-030616-622 adam8a|OTTDARP00000001783 adam8-001 LG_ AL831745.3 Danio rerio protein_coding KNOWN, 3251 bp
AGTCCCGGAGCGAGAGCACACACAGCACAGCGAGCCATGC
GATACACTGGACTATTTATAACGCTGCTTTCTTTCGTTTA
TACATGGGAGAGTCTGGAGGCTTTACCTCATGTGATGCGC
TATGATGTGGTCCGGCTTCAGGCATTGAGAGGGAGAACCA
GAAGAAGCGCCTCTTCCCTCCAGAAATATCCTGAGCAACT
TGAATATGATGTGGCTATAGATGGGAGAAACTTGACAATA
TCTTTGCACAGAAATAGAGAACTTTTAGGGAAACAATACA
CTTTGACACATTATGGCGAAGATGGGATTTCCGAGACAAA
GTCATCAAACAAATTTAATCACTGCTACTATCATGGACAC
ATCCATAATTTTGAAGATTCCTCAGTCAGCGTGGGACTTT
GTTCTGGAATGGAAGGATTTCTGAGAGTGAACGATCAGGT
TTATTTGATAGAGCCCTTGGAAGAGTCTTTGGATGGGGAC
CATGCTATTTACAAGCAAGAGCATTTAAGGACCAAGCGAG
GGGCCTATGGATACATTAATGACACAGTCTATGACCTTGG
CCCAAAGTCTAGTGGGCTGTATAAAGGAAAAAATATGAGA
AACAAAGCCCCGAGAGGAGGACAGCAGATCGTTGAGATGG
TTTTAGTTGTTGATAATACAGAGTACAAGAAGTTTGGAAG
TTTTAAGAAAATAGAAGAAAGAATGATGCTGGTCGCAAAC
CACGTAGACAAGCTTTACCGGCCTTTAAACATACGTGTCA
TGTTGGTTGGACTGGAGGTTTGGTCTCAAAGAGACTTAAT
TGATGTCAGCAGTAGGCCAAATCTTACTCTGGAACGGTTT
TTAAAATGGCGTCGCGATAGCCTGCTTCAGAGGAAGAAAC
ATGATAATGCCCATTTTATTACTGGTATTGATTTTGAAGG
GTCCACAGTTGGGTTGGCTACATTATATGCAATGTGCTCT
TCTTCATCCTCTGGTGCTGTGAATGAGGACCACAACAGCA
ATCCCATTGCAGTGGCTTCTACAGTTGCACATGAAATGGG
ACATAATCTGGGAATGTCACATGATGATTCAAGCTGTGGA
TGCTCCTCTAACAAGGGCTGCATTATGGGAGATACCATTG
GGTCTATTTACCCAGATTCATTCAGTACTTGCAGTCAGTC
ATCTTTAAAGGCGTTTTTGGAGAACTATGACACCAACTGT
CTAATAGATGTGCCAAATGAGGGTCAGATATATGGAGGTC
CAGTTTGTGGAAATGCCTTCGTTGAAAAAGGCGAGGAGTG
TGACTGCGGAACTGTTGAGGAATGCAACAACCCCTGCTGT
AATGCCACCACTTGTCGACTAACTGAAGGTGCCCGTTGTG
CACATGGCGAGTGCTGCCACAATTGCCAGCTGAAACATAC
AGGCAGCCTGTGCAGAAAAAGTGCTCACGACTGTGATTTG
GACGAATACTGTACAGGAGAGTCAGCTTTCTGTCCTGAAG
ATGATTATAAGATGAATGGACTCCCCTGCAATTATAATCA
GGGATACTGTTACAACGGACAATGTCCAACACACAAGGAA
CACTGCAAGATGCTGTGGGGATCAGGTGCTGATGTGGATG
ATGACGCCTGCTTTCAGTATAATGTGATTGACAGAACCTC
CAAAAGCGCTGAACACCGAAAATGTGGGAGAATATACTGT
TATGGTGGGAATCCTTTTCCAAAAACCAACAAAAAAGCAA
ATGTAAATGTTCAATCAAGAACCTGCTACATGGCTTTGGA
TTCATCACCCACAGAAGACTTAGGCATGGTTCCTACAGGC
ACCAAATGTGGCACAAATAAGGTGTGTTACAAAAGCCTTT
GCCTCGATATCAGTATGTACGGCACTGAGAACTGCTCGAA
TAAATGCAACAATCGTGGGGTGTGCAACCACGAGTTGAAG
TGTCACTGCGATCCAGGCTGGGCACCACCCTATTGTGATA
TTCAACTCTCAGAACTTCACAAAATGAGAAAATCTGTGGT
TATTGGTGTTACTACATCTTTAGCCATCCTTGTGCTGATC
ATTATTATTGGAGCGCTGGTGTATAACAGAAACAAAATAA
CAGAATTTAGAAAGAAAAGGCCACAGAAGGGCATCCACTC
TTCTTCAGGCCAATGCAATCCTGCATTTCAACCAGGAAGC
GCAAAGAACAGCCCCAGAATTGCACAGCCACGTATCAGTC
AACCAACTTTCCTTGAGTCGTCTGCTACTCAGGCCTGTAA
ACCTCTTCGGTCTGCGGCTATGCCCTGTAGACCAGCACCA
ATGCCTCCAAAGAATGCACCACAGACCAGAAATGAACAGA
TAATGAAGCCTCCTGTACCACCTTCTGCCATTTCCAAAAA
TATTTATCCTCCTCAGGCAAAACCCCTACTGCCAGCAGCT
AAACCCCTGCCTCCTTCAAGACCATTACCACCACTGGCAT
CTAAAGCTGTGACTAAATCCAAATCACCTCCAGTGCCTCC
TGTGAAACCCAGCGGGCCTCAGCCAGTATTCACTCCACCT
CAGGTAATCCAGAAAGTTGCACTGAAACCTCCAGCGTGGC
CCAGATGATCTGGAGCAGTATGAGTTACTATGAATCACTG
GGAGCCTCAGAAGAAGCGGTTCATGAGCTGAACAAAGCTC
TTTCTTTGTGGTGTGGCTCTGAATAGTAAGATGACGTTAA
GGAAGGGAAAGATGGTGACCGAATTTGCACTCAAGGAATC
ACTCACTTTACTGATTTGGTACGATTTGTTTGTACTGTCG
TCTGCTGAATTTTGTGCTTTCTTTATTATCTATTTATTTT
AGGCTATTTTAATTTTAAAGAATGTTATTCAGCTGTTTAC
AGTCAGCAGTTTCTGACTGACTCCATGTAAGTCTACTAAG
TGAGAAAGGAAAGAGTCTGTCATGCAGTATAAAAGTGTGT
TCATTCATGTTTCTGAAACGTCATGTATTTGGCATTTTAT
ATCTTTAAATTGAAATCTTATTTTCATTATTTTAGGTAAT
TTCTTGTAATTTCAACATACTTTATCTATTTGGTCTTGTT
TACCTCATTTCCTTTTTACAATATTTAACTTTCATACGTT
TTTCTTGTGATCCTTTTGCACTCAGACTAAGGCAAACATT
TGTTTTGCCCGCCTAATGTTTAGACTTCAAGTTTGCAATG
ATCTCAGCTGGGCTGATTTTACTCTTTAAATGTGAGAATG
CTCTCTTTTTTATTCTGTGTACTGTAATAAACTTTTTCAC
GTTTCTCAAAA

adam8a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA adam8a-201 3251
ncRNA adam8a-002 (1)    Ensembl 650
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
adam8a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000002026 (1),  Ensembl_Trans:ENSDART00000001678 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC057428 (1) 3304 nt
CITATIONS (2)