ZFIN ID: ZDB-TSCRIPT-090929-3768
Transcript Name: uhrf1-201
Previous Name: uhrf1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017422 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017422|OTTDARG00000014587|ZDB-GENE-040426-2039 uhrf1|OTTDARP00000014750 uhrf1-001 LG_ BX927276.23 Danio rerio protein_coding KNOWN, 5079 bp
TCGCGGCAGGACTGAACTCTAACAAAAGTGCAGCGTTTTC
ACACTTTCATCACATTCACTGAATCAAAATCACCTCTTCT
GTTCCCGAGAAGAAGATAACAGGTTTGCCGCCATGTGGAT
TCAGGTGCGCACTATGGATGGTAAGGAGACCCATCGGGTC
GACTCCCTGTCCAAGCTCACCAAGGTGGACGAGCTGCGTG
TGAAGATCGCCGAACTCTTCAACGTCGAACCCGAGCGGCA
GAGACTCTTTTACAGGGGCAAACAGATGGAGGATGGTCAC
ACCATATTTGACTATAACGTGGGTCTAAACGACATCGTTC
AGCTGTTGGTTCGGCAGGCGGTTGCAGCCACGGTGCTACC
AAAAGACAAGGAGGCAGAGCTGTCGGACTCCGACTCCGGC
TGCGGATCGGCTCAGAGCGAGTCTGATAAAGGATCCACAC
ATGGTGAGAGCGACGTACAGAGCGCCGGAGCCTCCGGACA
GACAGACACAGCAGACCTCATCGACCCTGGCTTTGGCTTT
TACAAGATAAATGAGTTTGTGGATGCTCGAGACCTGAATA
TGGGTGCCTGGTTCGAGGCTCAGATCGTCAAAGTGACGAA
AACTCCAGCTGAAGATGGAGGAGCTGAGGATATCGTTTAC
CACGTCAAATATGAAGATTACCCAGAGAACGGTGTGGTGC
AGCTGCGTGGGAAAGACGTCCGTCCGCGGGCGCGAACCGT
GTACCAGTGGCACCAGCTGGAGCCGGGAATGATTGTGATG
GTGAACTACAACCCTGACGACCCCAAAGAGCGCGGATACT
GGTACGATGCCGAGATCCAAAGGAAGAGGGAGACGCGCAC
TCAGCGGGAGGTGTTCGGCAAGATCCTGCTCGGGGATGCT
GGTGATTCCCTGAACGACTGTCGCATCATGTTTGTGACTG
AAATCTACAAGATCGAGGAGCCGGGAAGTGCCGAGGGTCC
AGGAGCCTCTTCTGACAGCCCTCTCAAGAGGTCGAACGGT
CCGGAGTGTAAGGTGTGCAAAGACGACCCGAAGAAGAACT
GCCGCGTCTGCAACTGTCACGTGTGCGGCATAAAGCAGGA
CCCCGACAAACAGCTGCTGTGTGACGAGTGCGACATGGCC
TTTCACACCTACTGCCTGAACCCACCGCTCACCACCATAC
CCGACGACGAAGACTGGTATTGTCCCGATTGTCGTAATGA
CGCCAGTGAGGTGGTTCTGGCCGGAGAGAAGCTAAAGGAG
AGCAAGAAGAAAGCCAAGATGGCGTCTGCCAGCTCGTCCA
GCCAGAGGGACTGGGGGAAGGGTATGGCGTGTGTGGGACG
CACCAAACAGTGCACCATCGTCCCCTCAAACCACTACGGC
CCCGTTCCTGGAGTCCCGGTGGGAACACTCTGGAAATTCA
GGGTACAGGTCAGTGAATCAGGCGTCCACAGGCCTCACGT
GGCAGGAATTCACGGCAGGAGCAATGACGGCGCTTATTCT
CTGGTTCTGGCTGGAGGTTATGAAGACGACGTGGATGATG
GGAACGAGTTCACCTACACAGGCTCCGGTGGACGAGACCT
GTCCGGAAACAAAAGGACGGCCGAGCAGTCCTGCGACCAG
AAGCTGACCAACATGAACCGGGCTCTCGCTCTGAACTGTA
ACGCAGCAGTGAATGATAAGGAAGGAGCTGAAGCTAAAGA
CTGGAAGGCTGGGAAACCGGTGCGAGTCGTGCGCAGCTCT
AAAGGACGCAAACACAGCAAATACTCTCCCGAAGACGGAA
ACCGATACGACGGCATCTACAAGGTGGTGAAGTACTGGCC
GGAGAAGGGCAAGTCTGGATTCCTGGTCTGGAGGTATTTA
CTGAAGCGAAACGATGAGGAATCCGCACCGTGGACCCGAG
ATGGAAAAGAGCGCATCAAGAAACTGGGCCTCACCATGCA
GTATCCTGAAGGCTATCTGGAGGCTGTAGCTGCAAAAGAG
AAGGAGAAAGAGAACAAAAACGAAGACGACATTGAAGAAA
CGCCAACCAAAGGCAAGAGGAAGAGGAAATCCCAGAGCAT
GGAAGAGAAAAGCTCTCCGACCAAAGGGACGCCGAAGAAG
ATGAAGGTGGAGGCGTACAAGCTGAGCAAAGAGCAGAAGG
CGCTGATCAAAGACGACGAGCTCAACAAGAAGCTGTGGGA
CGAGGCCATGGAGTCGCTGAGTCTCGGGCCGCGCTTTGTT
AATAAAGTGGAGGAGGTTTTCCTGTGCATCTGCTGCCAGG
AGGTCGTCTATCAGCCCATTACTACAGAGTGCCAACACAA
CGTCTGCAGGGAATGCCTTCAGAGATCTTTCAAAGCCAAG
GTCTACACCTGTCCGGCCTGCCGACACGACCTGGGCAAAA
ACTACCAAATGGCGGTCAACAAACCCCTCCAAGCCATCCT
CACCCAGCTCTTCCCCGGATACAGCAGCGGCCGGTGTTGA
CGATGTCCAAAACGCGCCTTACAATTCCACGAATCAAAAT
GCATTTCGTGTTTTTAAAATTATTTTACAAATACGTCAGG
TTGTTGTAGCATGGATCGAAAAATGTTGATTCAGCCGCGC
TACAGGATTTGTGATCTGACTGTCTAGCCACTCGACTTCT
GTCCGTTGTAGTTGTTTTTTTTTTCTGAATTGCGAATTTA
CAAGTAAAGCTGATTTCTCTAGCGATCTAGATGTGTTTTA
GCTATAGTTGCTTCAATGACATATTGTCTTGTATGCTACA
CACCAGCACAATGAACTGCAGCTATGCACAATTACGATGT
TCGTTAACATTTATCGCAGTGATTTTGTTATTCTGATTAA
TTGTACAACAGCATTGGATTTAGAATCCAGATGAATTGAT
GCCGTTTTTCAGTTAGAACCATAGCTATGCATAATTACTA
TGTTCGTTACCTGTTTCACAGTAATTTGTAAGTTTACAAT
GATTTGTACGAAAACCCTGCCTTAAGAATCCCGACCAAGT
AAACTAGCTGCAAACTTAGTCGCAAACATAACTGTGCATA
GATGGTTCATTCGTAAATTTAGTTAGCGCTAATTTAGTTT
GCGTCTTAAACAGCGTGTGGCATTTAACGTCTTTACCACA
ATATTGTTAGTGTTAAGTAAATTGAAATGAACAGTATGTG
ATGTTTGACGTTTTTACCATAACATCGTTACTGTTAGCTA
AATTTGAATCAACAGTGTGCTACGTCTGACTTTTTTATAA
TAGCATTGTTACCGTGTTTGTTTACCTTTTTGTCCCCGAA
ATTTTTCATTACAATCAATTGTACGAAATATATGCCTTTA
GAATCCCGACCAAACGTAACCGTATAGCTAGTTCATTTCA
GTTTAGTTGGTGCTAATTTAGTTTGCCGCATCGTTTGACG
TTTTTACCATAACATTGTTCGTATCAAGTAAATTGAAATG
AACCATTTAACGTTTTTACCTTAACATTGCTACCGTGTTT
ATTGACCAATGTTATTTGCAAAAACTTGTCATTTACAATT
CGTATGAAAACCCTGCCTTTAGAATCCCAACCAAACTATC
TATTTTCAAACTAAATTAGTCACAGATGTAACCGTGCATA
GTTTATTTCAATTAAGGTAACGCTAGTTTGCGTTTTTACC
ATAACATTGTTAGCTTTAATGAAATTGAAATGAACAGTGT
GACATTTGACATTTTTTACCATAACATCATTAGTTAACCA
ATTTAAAATGAACATTGTTGACATGAAATTAAGTGTGCAT
TTTTTTTTTTACCATAACATTGTCAGCATTTACTAATGTA
AAATAAACTAGCTATGCATGATTCGTTTCTAGTTTGAGGT
GCCAAAATTTTTATTTTACCTTCTTTGCCGCTTACTAAAT
TTAATTGGAGTTTCTATGCATTGTTGCAATGTTGCGATGC
TAATCTCCCAATAAGCTTTATGAACATCTATATTTCTTCA
TTTATGACATTAACACAACTTTGTGACTATTTGTGTTTCA
CGTGTTACCATCGTTAGTGTTAACATTGTATAAATGAGCT
AGCCATCCACTTTTCTCAATGTTTGTAATGCTAATCTCCC
AACTTTTCAGAGCAATATTTTGTTATTTAAGTTTAACGAA
ATTTTGTACGAGTTAAGAGTTAAATTTTCTATTACGGTAA
TGATTGTTGTATCATCTTTAGCATTAGCTATGCATTACCG
CAATGCTAATCTGTATTTTTCCACATGTATTCTTTTCTCT
TGACGCTAACACAACTGAGGAAAATTTCAAAGCGCAAACC
TTTTTGTTACCAACATTAGTTCTAACTGAATTTATAAGCT
AGCTATGAACTATCAGTGTTCGCGATTCTAATCTCCTAGA
TTGTTATTGCTTGTAATGCATTCACTTGACGTTAATAAGC
TTTTATATCGGTTTTGAGCCATGTCTAAATGTGCAGCAGT
AGCATTTTTACTGTACTATTGTTAACGCTAACTAAATATT
CGGATAAACTAGCTATGCACTGTTATGATGTTTCCGTGGC
TAATACTCCAACTCTTCACAAATTTATGGTGCCGTAGCTT
TACTAGCACACAGAAACGTTTGTTTACGTTTCGACTTTAT
TAAATCTTTTTATATTCTATTGCCGTTATTGGTAACTAAC
TAAATTTAACCTTAAATTGATTCATTTTTAACCAAATAGT
AATTTACGCAAATAAAACTTTGAACTTATACTTTTCGTCT
CACCCATTTTGATACGCGATTAAAATTTTTATATGCTCTG
AAGTTATTAGATATCCCACTTTGTTTGTTATTTGCTTTGC
TGTTTAACTGCTGTATGTCCTTTTAGAAGTGGAGTGTCAT
TTTCACACTAACTTTTGCCGTTATGCAAACAGTAGTCATG
TGCGCGAAACTAGTCCACGATCTGTATTTCAGGTGCATTT
TTGCGTCGATCCTGGATCTGGTTTTAAGCGTCTTGATTTT
ACAAAGGTTTTCGAGGGTAAATCCTTAAACCATTTTTCCG
CACAAAGCCCCAACAGTTTTTCATTCAGGAAGTATTTAAG
TGCATCGTCTTTTTCGCCTTGATGTTTTTCGCTTGTTACT
ATAGTATTTGCTAAATAAATGCCTAATGGCTGCAGATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
uhrf1-201 Contained in:
OTHER uhrf1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000017422 (1)
  • Ensembl_Trans:ENSDART00000169317 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC058055 (1) 5099bp
    GenBank:AY648713 (1) 2454bp
    GenBank:CN015018 (1) 945bp
    GenBank:CO919122 (1) 868bp
    GenBank:CK679536 (1) 862bp
    GenBank:CN329020 (1) 861bp
    GenBank:CN508182 (1) 855bp
    GenBank:BM141511 (1) 852bp
    GenBank:CV482417 (1) 792bp
    GenBank:AL723047 (1) 789bp
    GenBank:CK026524 (1) 785bp
    GenBank:CK692010 (1) 773bp
    GenBank:AL720734 (1) 762bp
    GenBank:CD053094 (1) 755bp
    GenBank:AL723250 (1) 754bp
    GenBank:AL723334 (1) 741bp
    GenBank:AL723902 (1) 727bp
    GenBank:AL720735 (1) 715bp
    GenBank:AL720741 (1) 703bp
    GenBank:AL718713 (1) 698bp
    GenBank:BF157863 (1) 672bp
    GenBank:AL723886 (1) 664bp
    GenBank:AL720828 (1) 648bp
    GenBank:BI673520 (1) 634bp
    GenBank:CO356360 (1) 610bp
    GenBank:AW594981 (1) 572bp
    GenBank:CK688360 (1) 550bp
    GenBank:AI883546 (1) 547bp
    GenBank:CR927056 (1) 539bp
    GenBank:AI588113 (1) 531bp
    GenBank:AI588206 (1) 495bp
    GenBank:CK695773 (1) 489bp
    GenBank:AW058912 (1) 479bp
    CITATIONS (2)