Transcript

kdm4b-201

ID
ZDB-TSCRIPT-090929-3766
Name
kdm4b-201
Previous Names
  • jmjd2b-001
  • kdm4b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000017420 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000017420|OTTDARG00000014585|ZDB-GENE-060503-664 kdm4b|OTTDARP00000014748 CH211-124A3.4-001 LG_none CU074310.7,BX927276.23 Danio rerio protein_coding NOVEL, 5293 bp
AGATCGCGCGTCACGCTGCAGTGGGAGGAAACGCGGCCCA
GCGTTACTGAAACATTATCGAGCCTGTGGAATAGCGAAAA
CGGACATATTCGAGGCAAAAACAACGACAAAAGAGCACAA
AACGAGCCCGAGCAGCAGCGTTCGCTGACCTGCAGTCATG
GACCCATCTTTACCTCCAGACCCAAACCCAGCGGAGACGG
AACCCTCTGCAGACGTGACTCCACCAGCAGACACTGATCA
GGACTCTCCTATTAACCCTCTGGTGGATCCACAGCCATGC
GACACCCCTATTTCAGATCTAGTCCACGAACCGGCGGCGC
CCGCAGAACCGACCCCGGCTCAAGGACTGAAACCAGAACT
GCCTGCACCAGAACTCACAACACAAAACCTGATCCCAGGA
CCGGCTCCGGCTCCTCCACCCGGCGCCAACTTCAACAAGA
TCATGACCTTCAGGCCCACCATGGAGGAGTTCAAGGACTT
CGGGAAGTACATCGCCTATATGGAGACGCAAGGAGCTCAC
GTTGCCGGACTGGCGAAGGTTATTCCGCCGAAGGAGTGGA
AACCGCGCCGTTCCTACGAGACCATCGAGGATATGGTCAT
TCCTGCTCCCATCATGCAAGTGGTGACCGGCCAATCTGGG
CTCTTCACACAGTACAACATCCAGAAGAAGTCCATGACCG
TTGGAGAATATCGCAAACTGGCCAACAGTAAAAAGTACAA
CACTCCTCAACACAAGGACTTTGACGACCTGGAAAGGAAA
TACTGGAAAAACCTGACGTTTGTGTCGCCTATTTATGGCG
CAGACATCAGTGGGTCACTCTACGACCCGGACATTTCGGA
GTGGAACATCGGCCACCTGAACACTCTCCTGGACATGGTG
GAGCAGGAGTGCGGGATCGTCATCGAAGGTGTGAACACAC
CGTACCTGTATTTCGGCATGTGGAAGACCACCTTCGCCTG
GCACACAGAGGACATGGACCTCTACAGCATCAACTACCTG
CATTTCGGAAAACCAAAGTCCTGGTATGCCATTCCTCCCG
AGCACGGCAAGAGGCTGGAGAGGCTGGCGCAAGGATTTTT
CCCAGGAAGCTCCCAGGGCTGCGATGCCTTTCTCCGACAC
AAGATGACCCTCATTTCTCCCTCAATCCTCAAGAAGTACA
GCATCCCGTTTGACAGGATCACGCAGGAGGAGGGTGAGTT
CATGATCACCTTCCCGTATGGGTACCATGCCGGCTTCAAC
CATGGCTTCAACTGCGCAGAGTCCACCAACTTCGCCACGC
TGCGCTGGATCGACTATGGCAAGATGGCGGCGCAGTGCAC
GTGCCGCAAGGACATGGTGAAGATCTCCATGGATGTGTTT
GTGCGCCGCCTGCAGCCGGAGCGTTACACGCAGTGGAAAC
AAGGTAAAGACACAATGGTGCTGGACCACCTGAAGCCCAC
CAGCCTGAGCAGCCCCGAGCTGGAGCACTGGAGGAAGAAC
AGAGTCACCTTTAGGGAGAAGGTCCTGCGCAGAGCTCAGG
CGAAGATGAAACAGTTTCGGCGTCTGAAGCCGGAGGACCT
GAAGGTGCTGATGGAGGCGGGTGTGGAGCTGGACATGGAG
GAGTACCAACGCAAGGTGGAGGAGCATGACGAGCAGCGGC
GCCAGCAGAGGGACGAGCGCATGGCCAGAGAAGCCATGCT
CACGCTGGAGGCGCTGGAGAGAGAAGAGCAGGAGCAGGCC
GAGGCAGCGCTTCGAGGAGGAGGAGTTGAAGAAATAAAAG
CCGATTTCCAGGATCCTCCAGTGGAGAACGGAGAAAAGAA
GAAGAAAAAGAAGAAAAAGCTTCAACTCACAGATGAAATG
TCCTTCCAGGAAGTGTTTGAGCAGTTCACCACCGCCAGCG
AAATGCAGAACCAGAGCAATGGAGCTGCCCCTCTGCAGAC
AAATCCGTTCACGAAGCTGAAGAAGAAGGTTGAGGTGAAG
AAGAGCCGAAGGCATCCAATCAGCAAACCGCCGATGCGTT
CGCCTCACTCCATCGTCAAACAGGAGGCCTCCAGCGATGA
GGAGCTCTACTCAGGGCTGCCAGTAGGTGGCGGTGTCACT
CACGAAAGCAAGAAGCCCGAAGACAGCGACCTGTGGCAGA
ACCGTTCGCCGAACTTCCTAGCCGAGAAACAGTTCAACGC
GGCCATGTCCACCATTGAGCCGTACTGCGCCATCTGCACG
CTCTTCTGCCCGTACACACAGTCTGTGAAGGACCCCTTCC
ACATCTCGGACATGTCTGGTCTGGTGTCGCGGGTCGGCTG
CCGCACTCGTCCGCTGGTTCCCGAGATGTGCTTCAGCGCC
GGAGCCGAAAACATGGAGCCGCTTTCCTCAAACTCCCACA
TTGCAGACGACGGCACCAGCGTACTGCTGTCCTGCTCCGG
CTGCAACCTGCAGGTCCACGCCAGTTGTTACGGCGTCAAC
CCTCAGACAAAACAGGAGGGCTGGATGTGTTCTCGGTGTA
CTACGGTGGCTTGGACAGCCGCCTGCTGTTTGTGCAGTTT
AAGAGGAGGAGCGTTAAAGAAAACCACAGATGAAAGATGG
GTTCACGTGATCTGTGCCATCGCTGTAGCCGAGGTTCGTT
TCGTTAATGCTATTGAGCGTGAGCCTGTGGATGTGACTGC
GGTCCCTGAAACCAGGAAGAGTCTGAAATGCGTGTACTGC
CACAAGACGACCAAGCAGATTTTCGGCGCATGTATCCAAT
GCTCACAGGACAACTGCTCCACGTCTTTCCACGTGACCTG
CGCCCTCCTCGCCGGAGTCGTCATGAAGCCTGCTGATTGG
CCGTATGTGGTGTCCGTCACCTGCCACAAACACAAACTGA
CTAATCAGAAGGCTAAAAGTGGCTCTCGCGACCTTTCTCT
GGGTCAGGAGGTCATCGGCAGGAACAGCAATGGCTGGTTT
TATCGCTGCGTCATCACCGGCACCGGCACACAAACTTACT
ACGAGGTCAACTTTGACGACGGATCCTACTGTGACAACAT
CTTCCCAGAGAACCTGCTGAGTCACGACTGCCTGCGGAAC
GGCCCGCCAGAACTGGGCGAACTCGTGGTGGTCAAAACTG
TCGATGGACGGGTTCTCAACGCATCTTACATCAAGGAACA
CGTCCACCGATACTACCAGGTGGAGTTTCAGGACGAGACG
CAGCTCTTACTGAAGCGCAGCGAGATTCACTCTCTGGACC
AAGAGCTGCCCAAGAGGGTCATGTCTCGTCTGGCAACCGT
GAACCAGCAGCAACCTCAGGCTCAACCATCAGACGAACCT
CTGGCCGCAAAACGCCCTCGTCTGCCGACCCCGCCGCCCA
CGTTAGCCATCGAGCCCTCTGCGCTACCTCCTGAGCTAGT
CTCCACTTTCCTGCCCCCTAGTATTACCGCGAACACCAGC
ACTGCCCCTTGCTTGCCACCAGCTGCACTACCCGTTTCAG
CGCCCCCAGAACCCAGCGAGAGTTACACCCACAGCTCCAG
CTACATCGCCTACATGGAGTCTCTCCTCAAGTCGGACTTT
CCCGCGGAAGACGGCGAGCCCGGCCTCGAGCCTATGTATT
GAAGCAGCTAACGCTTTCAGACTTTCAATTCATTCACTTG
CATGTCTTTGTTTCATTTATTCGCTGTTGTGCTAATCGGA
GTCCTCCCACCCATTGATGGTGCGCGTGGGACGCATGTGT
GTCACTATAGACTGAAGCCGGAACGGACCCAGTACAGAGC
CTTGGGGGGATGCCGTGCTCTTCCACGACCCCTCAATTCG
CCTCTTTCAATAAACGAAAAGATCCCACCACCGGAACGAT
CACCTACTGTATGTGCTGTTTACTTTAACACGGACTTTTT
CTTTTCTCTAATGAGTGCTAAATATTTTTCTAACGCGACT
CAAAACACGCTACCCGGTCACAGATCAACAGCCAGTCTAT
ATCTGTACAGTTTCCGATATTTCTCAAGTGTTCGGGGAGG
GATGGGGGGGGACCACAGGAAGAGTTTTAGCGGGGATTTA
ACAAGTATTTAAACGTCTTTTGTCACATATAGATTTAATA
TTTGTATAAAGGAAATCACAACTATGGCAGCATCAGAAGC
TACAGTTTGTTTGTTTTTTTGGGTTAGCGTACGCATTACG
ATAGATCTCGCGCGTCTTCATGTATACTTCTATAATCGAC
GATAAAAATGTTTTTCAGCGCCAGGTGAATGATTTTTTTT
GTAGCATACTTGGTAGACGTTGATATTGAAATACTATTCA
CCTCGTCTGTTTTTTATTATATTTACTGTTGTTGTTATGA
TTATTATTTTTATTGGTTTATAATTTTCGGTGCAACGGAG
TTTCGGGAGATTTAACGGAAAAAAAAATGCAAGTGGAATT
GATCGTTTTTATTGAGGAGTTCGGCATACATTTAAGCGTA
TAGTCATAGGTGAGGTTAAACATGCGCAATCCGCCTTCTC
AAGGTGCTATAGAGGTCAGAGACTACTGAGGGGCGTTGGG
ATGAGGTGTACATACTAGACGTCCTGAACATCGACATTCT
TCTTCAGTGTAACTTCTAGTCTTATCGAATGCCATGTCAC
GTTCTAATAAAGGGTCTGGGTGTCGCTTTGAATTGGTTTT
CTCCTTTTTTGTTGGTTCTCCATCTTGTTTGATCTCATGA
CGTATCACTGGTTTTCTCGTCCAATTAGCATCGAGAATTC
ACTTCAAGGCCATCTTGGTTCATTCAGAAACAAAGGCTCG
GATCAGATCTTTTTAGAAACGATTGCTTTAGCATGCCAAA
GAGTTCAAAGAAGCGTCCAAGACGCAGAATAAATAAATAA
ATGCATGAAAAGTCAAGACGTGTGACAGAAAAGGCGTGAT
GAATTGCATTGATTCCCTTTGCATTACTTGTGAACACTTG
CATTAATTTGACAGCGCTTCTGTTTATTTTTATTCTTCTT
ATTATTATTAGAATGATTTATAATCCAAGTTACACCTTTA
ATCTTTTGGGATGAAGTGCGTACTGAGGTTATATCTGCTA
CACCGTCTCGAGCGCATCCTTTTTGATGTGACGACTGTCG
TTTTCGTCTCAACGCTTCCGTTTGTTGTTTTCCACCTGTC
AGCGACGCCTACGGCCGCTCCAAGACTAGACTCAGTGTGT
CAATGGCATTTGTACTCCTCTGTTCTTGAAGTTTCTGCCT
TGCATTAACAGAAACGTCACGAGAGGCAGGTTTAATGAAA
TAACCCAACACGGCTTGCATACTGATGGTGGCAAATGTTT
ATCTGTGCAGAAGTAATAGGAAAGATTCTAATAAAATGTG
AAGTGAAACTGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations