header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3716
Transcript Name: cndp2-202
Previous Name: cndp2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017275 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017275|OTTDARG00000014461|ZDB-GENE-030131-5499 cndp2|OTTDARP00000014627 cndp2-001 LG_ BX957344.6 Danio rerio protein_coding KNOWN, 2142 bp
GAACTTGAGATGCGTTTGATGGCTGTCTTCACACCCCTGA
AAAAACTGTGACAGAGCAGTTCGGTTTCTGTTATTTTAAA
GACATTGAAGTTTCTACTCATTCTTCTGTCACTGAGGGAT
TGTCACTGTGCAGCAATGTCTTACCTACCAAATCTCTTCA
AATACGTTGACGAGCACCAAAACGAATATGTTGAGCGCCT
GGCACAATGGGTTGCTGTACAGAGTGTGTCTGCCTGGCCA
GAGAAACGAGGAGAAATCAAGAAAATGATGGAGATGGCAG
GCAAAGACATCGAGAGACTGGGTGGAACTGTGGAGTTGGT
TGATATCGGCATGCAGAAGTTGCCAAGTGGTGAAGAGATT
CCCCTTCCTCCAATAGTTCTGGGCAGACTTGGCTCTGACC
CGGGCAAGAAGACTGTTTGCATTTACGGACACTTGGATGT
GCAGCCGGCCAGCATTGAAGATGGCTGGGACTCACAACCC
TTTATTCTGGAGGAGAGAGACGGTAAAATGTACGGACGTG
GATCCACAGATGATAAAGGCCCTGTACTGGCCTGGTTCAA
CATCATTGAGGCCTATCAGAAGATTGGACAGGAACTGCCC
ATCAACATAAAGTTCTGTTTCGAGGGAATGGAGGAGTCTG
GATCAGAGGGACTGGATGATCTGGTCTTCTCTCGCAAAGA
CACTTTCTTTAAGGATGTGGACTACGTCTGCATTTCTGAT
AACTACTGGTTGGGAAAGACCAAGCCCTGCATTACCTACG
GCTTGAGAGGAATTTGCTACTTCTTTATTGAGATGGAATG
CTGTGATAAAGATCTCCACTCTGGCGTCTTTGGAGGATCT
GTTCACGAGGCTATGACTGACCTAATAGCGCTGATGGGGA
CTTTGGTGGACAACAAGGGAAAAATTAAAGTACCAGGAAT
ATACGACCAAGTTGCTAAACTGACTGATGAGGAGAAGAAG
CTTTATGAAAAAATTGAGTTTGACTTGGAAGAGTATGCCA
AAGATGTTGGAGCTGGCAAACTAATGCATGACACCAAAGA
GCAAATTCTGATGCATCGTTGGAGATACCCATCCCTGTCT
CTGCACGGCATAGAGGGAGCCTTTTCTGAGGCTGGTGCCA
AAACTGTCATCCCCCGCAAGGTCATTGGCAAGTTCTCAAT
CCGCCTGGTCCCTGACATGGATCCCAAAGTGGTGGAGAAG
CAGGTAATTAGCCATCTGGAGAAGACATTTGCAGAGTTGA
AATCTCCTAACAAACTGAAAGTGTACATGGGACATGGAGC
GAAGGCCTGGGTGTCTGACTTTAATCATCCTCACTACATG
GCTGGGAGAAAGGCCATGAAGACTGTGTTTGGTGTGGAGC
CTGATTTGACCCGTGAGGGAGGAAGTATCCCAGTAACTTT
AACCTTCCAAGAAGCAACCGGCCAGAACGTCATGTTGCTT
CCTGTTGGATCCTCTGACGATGGCGCTCACTCACAAAATG
AGAAACTTAACAGATCCAACTATATTCAGGGGACCAAGAT
GTTGGGAGCGTACTTCTATGAAGTATCTCAGCTTAGTTAA
CTAGAACATCTGACTCGGCTCGACTAGGCTGGTGCATTTT
TATTTGTCTGAAGGTGTGAATGAAATTCCTGGATAAGGGT
ACAGTCTTCAAGTTTTCATTTCATTTACCGATGAAGAAAA
ATGGTGATGGTATGGTATTACTTTGAGCCAAATGACAATC
AAGCTTTTTTTTGCAGTATCACGTTAAAAACACAAAACAA
AAACATAATCACTCCGTTCAGCCATTTCATTGCTAGATTT
TCCAGAATTATGATGATTTTTCATGATGTAAGATGCATTT
CCACTCAGTTTATTCTTTACTCCAGTTCTCTCTAAAATGA
TCCATCAAGCAACTGATGACACATGCAATTTAGAGCAAAA
AAACATACATTTCTTCAGCTGTATAATATTTCTAGCTGCT
GTAATAGTAATCTCTGTGTTAGTGTCTAAATATCTGATTT
TCAGTTATGGTTTACATAATGGAGTAAACTGCCTTTTTTG
CAATGTGAAATGACACGATCGGTTTTCTAGTGTATTCTGT
GTACACATGACATATGCACAACCATAAATGCAAATCATCT
CAATAAAATTCAACTTTGATTA

cndp2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cndp2-201 (1) 2064
cndp2-202 2142
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cndp2-202 Contained in:

OTHER cndp2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000017275 (1)
  • Ensembl_Trans:ENSDART00000143457 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY391414 (1) 2056bp
    GenBank:DV586769 (1) 894bp
    CITATIONS (2)