header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3717
Transcript Name: cndp2-201
Previous Name: cndp2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017276 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017276|OTTDARG00000014461|ZDB-GENE-030131-5499 cndp2|OTTDARP00000014628 cndp2-002 LG_ BX957344.6 Danio rerio protein_coding KNOWN, 2064 bp
ATTTGTGTTTCTTTCTGGTCAGTTCTTCTGTCACTGAGGG
ATTGTCACTGTGCAGCAATGTCTTACCTACCAAATCTCTT
CAAATACGTTGACGAGCACCAAAACGAATATGTTGAGCGC
CTGGCACAATGGGTTGCTGTACAGAGTGTGTCTGCCTGGC
CAGAGAAACGAGGAGAAATCAAGAAAATGATGGAGATGGC
AGGCAAAGACATCGAGAGACTGGGTGGAACTGTGGAGTTG
GTTGATATCGGCATGCAGAAGTTGCCAAGTGGTGAAGAGA
TTCCCCTTCCTCCAATAGTTCTGGGCAGACTTGGCTCTGA
CCCGGGCAAGAAGACTGTTTGCATTTACGGACACTTGGAT
GTGCAGCCGGCCAGCATTGAAGATGGCTGGGACTCACAAC
CCTTTATTCTGGAGGAGAGAGACGGTAAAATGTACGGACG
TGGATCCACAGATGATAAAGGCCCTGTACTGGCCTGGTTC
AACATCATTGAGGCCTATCAGAAGATTGGACAGGAACTGC
CCATCAACATAAAGTTCTGTTTCGAGGGAATGGAGGAGTC
TGGATCAGAGGGACTGGATGATCTGGTCTTCTCTCGCAAA
GACACTTTCTTTAAGGATGTGGACTACGTCTGCATTTCTG
ATAACTACTGGTTGGGAAAGACCAAGCCCTGCATTACCTA
CGGCTTGAGAGGAATTTGCTACTTCTTTATTGAGATGGAA
TGCTGTGATAAAGATCTCCACTCTGGCGTCTTTGGAGGAT
CTGTTCACGAGGCTATGACTGACCTAATAGCGCTGATGGG
GACTTTGGTGGACAACAAGGGAAAAATTAAAGTACCAGGA
ATATACGACCAAGTTGCTAAACTGACTGATGAGGAGAAGA
AGCTTTATGAAAAAATTGAGTTTGACTTGGAAGAGTATGC
CAAAGATGTTGGAGCTGGCAAACTAATGCATGACACCAAA
GAGCAAATTCTGATGCATCGTTGGAGATACCCATCCCTGT
CTCTGCACGGCATAGAGGGAGCCTTTTCTGAGGCTGGTGC
CAAAACTGTCATCCCCCGCAAGGTCATTGGCAAGTTCTCA
ATCCGCCTGGTCCCTGACATGGATCCCAAAGTGGTGGAGA
AGCAGGTAATTAGCCATCTGGAGAAGACATTTGCAGAGTT
GAAATCTCCTAACAAACTGAAAGTGTACATGGGACATGGA
GCGAAGGCCTGGGTGTCTGACTTTAATCATCCTCACTACA
TGGCTGGGAGAAAGGCCATGAAGACTGTGTTTGGTGTGGA
GCCTGATTTGACCCGTGAGGGAGGAAGTATCCCAGTAACT
TTAACCTTCCAAGAAGCAACCGGCCAGAACGTCATGTTGC
TTCCTGTTGGATCCTCTGACGATGGCGCTCACTCACAAAA
TGAGAAACTTAACAGATCCAACTATATTCAGGGGACCAAG
ATGTTGGGAGCGTACTTCTATGAAGTATCTCAGCTTAGTT
AACTAGAACATCTGACTCGGCTCGACTAGGCTGGTGCATT
TTTATTTGTCTGAAGGTGTGAATGAAATTCCTGGATAAGG
GTACAGTCTTCAAGTTTTCATTTCATTTACCGATGAAGAA
AAATGGTGATGGTATGGTATTACTTTGAGCCAAATGACAA
TCAAGCTTTTTTTTGCAGTATCACGTTAAAAACACAAAAC
AAAAACATAATCACTCCGTTCAGCCATTTCATTGCTAGAT
TTTCCAGAATTATGATGATTTTTCATGATGTAAGATGCAT
TTCCACTCAGTTTATTCTTTACTCCAGTTCTCTCTAAAAT
GATCCATCAAGCAACTGATGACACATGCAATTTAGAGCAA
AAAAACATACATTTCTTCAGCTGTATAATATTTCTAGCTG
CTGTAATAGTAATCTCTGTGTTAGTGTCTAAATATCTGAT
TTTCAGTTATGGTTTACATAATGGAGTAAACTGCCTTTTT
TGCAATGTGAAATGACACGATCGGTTTTCTAGTGTATTCT
GTGTACACATGACATATGCACAACCATAAATGCAAATCAT
CTCAATAAAATTCAACTTTGATTA

cndp2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cndp2-201 2064
cndp2-202 (1) 2142
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cndp2-201 Contained in:

OTHER cndp2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000017276 (1)
  • Ensembl_Trans:ENSDART00000038202 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC076079 (1) 2076 bp
    GenBank:CK871439 (1) 809 bp
    GenBank:AI722207 (1) 575 bp
    GenBank:CF101979 (1) 510 bp
    CITATIONS (2)