header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3694
Transcript Name: tra2a-201
Previous Name: tra2a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000017217 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000017217|OTTDARG00000014416|ZDB-GENE-040426-1391 tra2a|OTTDARP00000014586 tra2a-001 LG_ BX469899.6 Danio rerio protein_coding KNOWN, 1486 bp
GATTCGCCTCCCACAGTACACCGCGCGTTTCAGATGGTCG
GCCATTTTCTGCAGTTACATTAGGAGCGGAAGTCTTCGTC
GAAGAGCGTCTTCATATCCACGCTTTTTTTTTTACCAGTC
AATAATATTTTTAAAACAATGAGTGATACTGAAGAGCAAC
AATTCCAGAGGAGGGAATCTCGCTCGGCGTCCAAATCGGA
TCGGGGGAGTCCTGCCCAACCCAAGATGGAGAGCAGGTCT
GGTTCTCCCAGCCCTTCCAGAGCATCCAAGCGTTCTGATT
CAAGATCAAGATCACGCTCCAAGTCCAGGTCCCGCTCTCG
TCGGCATTCCAATCGGCGCTACAGCAGGTCTCGGTCCCAC
TCCCACCGGAAAAAATCTCGTTCTCGCTCCTACAGCCCTG
AATCCCGACGCAGAAGGAGCCGAAGTGCATCGCCCAATTC
TAACCGCCGCAAACACGCTGGCAGTCGGAGCTCATACAGC
CATGACTCCAAAAAAGATTCGCACAATCAGGGTGATGCCA
GGGCCAATCCGGACCCCAATACATGTCTTGGTGTGTTTGG
TCTCAGTCTGTACACGACAGAGCGAGACCTGAGAGAAGTT
TTCTCACGTTACGGCTCTTTAGCCGGTGTCAATGTTGTCT
ATGATCAGAGAACAGGACGCTCTCGCGGATTTGCCTTTGT
ATACTTTGAACACATCGATGATGCCAAAGAGGCAATGGAG
CGGGCTAATGGCATGGAACTAGATGGAAGACGCATCAGGG
TGGATTATTCCATCACTAAACGTCCACACACACCCACACC
AGGCATTTACATGGGTCGACCAACACATAATGGAGGTGGT
GGTGGAGGCGGCGGCAGCAGCAGCGGTGGCCGGAGACGAG
ACTCGTATTATGATCGTGGCTATGATCGCGGCTATGATCG
TGGATATGACGAGTATGACTACAGATACAGCAGGAGGCGC
TCTCCGTCCCCCTATTACAGCCGCTACAGGTCTCGCTCCA
GATCTCGCTCATACAGCCCACGACGGTACTAAGAAGATCC
TGATGACTCCCTCCTTCTCTTGCCTGTTCGCCTCAATCGA
TACATTTATTAAGACATGAAGTACATATAGCCTGTTGTAC
TAATTACTGATTTGTTAAATAAATGTCTTGATTTGTAGAC
TCTCTAGCATGTACGTTTAAGGTTTGTGGAGATCATAAAT
ACTGTCAGCTTGGGGTTTTATTTGTGATTGTTGTTTTTTT
TTTTTGTTCTCCTTTTGGTAGTGTGCTTATGTTTTATATG
CATCTTTTAGTGCGTATGTATGCTGTACTACGAAAATACG
TGTGTGAGTTGCTGTATGTCTGTGTGACAGAATCATGTAC
TTTGCGAAATCTGGCTGAGATTGCCTCTGTTTATCTGTGA
CCAGACAAAAAAACAACTTTATTTTCAGGATTAATGTTTT
GCTTAGTTTCTTTCTCAAGAAATAAAGAGCTCCAAAATAA
AATGGA

tra2a TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript tra2a-202 (1)    Ensembl 1043
tra2a-205 (1)    Ensembl 743
mRNA tra2a-201 1486
tra2a-204 (1)    Ensembl 984
tra2a-206 (1)    Ensembl 809
ncRNA tra2a-004 (1)    Ensembl 701
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tra2a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000017217 (1),  Ensembl_Trans:ENSDART00000008595 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC054632 (1) 1447 bp
GenBank:CN014642 (1) 860 bp
GenBank:EH604275 (1) 763 bp
CITATIONS (2)