header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3569
Transcript Name: krt92-201
Previous Names: krt92-001, zgc:109868-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016881 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016881|OTTDARG00000014149|ZDB-GENE-050417-363 krt92|OTTDARP00000014310 DKEYP-113D7.5-001 LG_ BX323079.7 Danio rerio protein_coding NOVEL, 1412 bp
GTACTCATCCGCTCACTTCTTCTCCAGGCAGAGCAGACGA
CGACAGCAGGACTCCATCAAAATGATGTCTTCTTCATCCA
CCCGCACCTACATGTCCTCAGGAGGATCTTCCCGAGTCTC
TGTCTCTGGTGGTGGAGCTGGTCGTGTCACAGGAATGCGT
GCCGGTAGTGTGTATGGAGGAGCAGGAGGATCCGGGGTTC
GCATCTCCAGTTCTTCTCTTTCTCGATCCTACTCTTCTGG
AAGCACTGGCTATGGCGCTGGCTTCCATCTGTCTGATGCC
ATTGACGTGTCTGCGAATGAGAAAGCCACCATGCAAAACC
TCAATGACCGTCTGGCCTCCTACCTGGAGAAGGTGCGCAC
CCTGGAGAGGGCCAATGCAGATCTTGAGCTGAAGATCCGC
CAGTTCCTGGACAGCAAGACGGCTCCCTCTGCTCGGGACT
ACAGTGCCTACTATGCAACAATCAGTGACCTCCAGGTCAA
GATCCAGCATGCTACTGGTTTAAACGGAGGGATCTACCTC
AGCATTGACAACGCCAAGCTGGCTGCCGATGACTTCAGAG
TCAAGTATGAGAATGAGCTGAGCATGAGGCAGTCTGTGGA
AGCAGACATCGCTGGCTTGAGGAGGGTGCTGGATGAGCTC
ACAATGACCAGATCTGACCTGGAGTTGCAGATCGAGGGTC
TGAGAGAAGAACTGATCTTCCTCAAGAAGAACCACGAGGA
GGAACTCTTGGCAGTGCGTGCCCAGATGACCGGACAAGTC
AACGTAGAGGTCGACGCAGCACCACAGGAAGACCTGACAA
AGATCATGGCTGAAATCCGTGAACACTACGAATCAGTTGC
TGCCAAGAACCGCAAAGATCTTGAGGCTTGGTTCCAGGCC
AAGACCGAAACCCTCACCAAGGAAGTTGCTGTGAGCACAG
AAACCCTTCAAATATCCCGCTCTGAAATCACAGAGGTTAA
GCGCACACTCCAGAGTCTTGAAATCGAACTTCAGTCACAA
CTCAGCATGAAAGCGTCATTGGAAGGTACTCTGGCAGACA
CACAGGCCCGCTATGCTGCCATGCTATCTGGCTACCAGTT
CCAGGTGAGCAGCCTGGAAGAGCAGCTGGTGCAGCTTCGT
GGTGACCTTGAGCGTCAAAGCCAGGAATACAAGATGCTTC
TGGACATCAAGACCAGACTGGAGATGGAGATTGCAGAGTA
CAGAAGACTGCTGGATGGAGAGGCTACAAGGTGAGACACA
ACAACACAATTCCACAACACGCAAGGTGGTAACCATTGTG
GAAGAGGTGGTGGACGGCAAAGTGGTCAGCTCATCCTCCC
AATCTACGAGCGAGGTTGTGTCTCAAAAGCATTAAGCAAC
AACAATCCACCTCAAGAGTGCTGAAAAACCAATAAAATGG
TCTAACTGTGAA

krt92 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA krt92-002 (1) 878
mRNA krt92-201 1412
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
krt92-201 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER krt92-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000016881 (1)
  • Ensembl_Trans:ENSDART00000027701 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF197880 (1) 1426bp
    GenBank:CK870397 (1) 935bp
    GenBank:DN833049 (1) 895bp
    CITATIONS (2)