ZFIN ID: ZDB-TSCRIPT-120213-859
Transcript Name: krt92-002
Previous Names: dkeyp-113d7.5-002, zgc:109868-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053195 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053195|OTTDARG00000014149|ZDB-GENE-050417-363 krt92|no_translation DKEYP-113D7.5-002 LG_ BX323079.7 Danio rerio protein_coding NOVEL, 878 bp
ACAGTGCCTACTATGCAACAATCAGTGACCTCCAGGTCAA
GATCCAGCATGCTACTGGTTTAAACGGAGGGATCTACCTC
AGCATTGACAACGCCAAGCTGGCTGCCGATGACTTCAGAG
TCAAGTATGAGAATGAGCTGAGCATGAGGCAGTCTGTGGA
AGCAGACATCGCTGGCTTGAGGAGGGTGCTGGATGAGCTC
ACAATGACCAGATCTGACCTGGAGTTGCAGATCGAGGGTC
TGAGAGAAGAACTGATCTTCCTCAAGAAGAACCACGAGGA
GGTAAAGTTGTGTTTGGTTCACACTCAGTAGTTCCTTTTG
ACATGCGAGTCAGGCAAATGCTCAGTGGTTTGCTATTGTA
CCTTCAGGAACTCTTGGCAGTGCGTGCCCAGATGACCGGA
CAAGTCAACGTAGAGGTCGACGCAGCACCACAGGAAGACC
TGACAAAGATCATGGCTGAAATCCGTGAACACTACGAATC
AGTTGCTGCCAAGAACCGCAAAGATCTTGAGGCTTGGTTC
CAGGCCAAGACCGAAACCCTCACCAAGGAAGTTGCTGTGA
GCACAGAAACCCTTCAAATATCCCGCTCTGAAATCACAGA
GGTTAAGCGCACACTCCAGAGTCTTGAAATCGAACTTCAG
TCACAACTCAGCATGAAAGCGTCATTGGAAGGTACTCTGG
CAGACACACAGGCCCGCTATGCTGCCATGCTATCTGGCTA
CCAGTTCCAGGTGAGCAGCCTGGAAGAGCAGCTGGTGCAG
CTTCGTGGTGACCTTGAGCGTCAAAGCCAGGAATACAAGA
TGCTTCTGGACATCAAGACCAGACTGGAGATGGAGATTGC
AGAGTACAGAAGACTGCTGGATGGAGAGGCTACAAGGT

krt92 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA krt92-002 878
mRNA krt92-201 (1) 1412
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
krt92-002 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER krt92-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053195 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CD052728 (1) 872bp
    GenBank:BI888904 (1) 776bp
    CITATIONS (1)