Transcript

foxa3-201

ID
ZDB-TSCRIPT-090929-3349
Name
foxa3-201
Previous Names
  • foxa3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000016207 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000016207|OTTDARG00000013633|ZDB-GENE-980526-423 foxa3|OTTDARP00000013760 foxa3-001 LG_ BX908751.8 Danio rerio protein_coding NOVEL, 2763 bp
AGAGCTGACACGGGCTCCACAGCTTCACTTTGGACTTCTC
AGGATTATACTTGAAAATGTTTACGGGTCACCAAAGTGAA
CTATAAGTTAACTAATCATGAAAAAACAACTGATTGATCT
ACGGGACAGAAGATAACAGAAGAGCCTGACTTCCAAAACT
TTATAGTTCATATTACGTGGAATTACAAAAGTTTCTCTTC
TTGTGGGACGTTTTGTTTGTTTATTTATTTTAAAAGCGAA
ATCCTTATAACAGCTCGAGGGCATTTTAGTACACGTTAGT
CGTCAGTCACTATCCCGTTTCTTACGAGTTACAACTTTAT
TTGGGGATGTTGAGCTCCGTGAAGATGGAATCTCATGAAA
TTCCGGAGTGGAATCCTTTCTACAGTGAGGCAAATGAGAT
GTATTCCTCTCCGAGCGCCATGAACTCAGTGAGCAGCTTG
AACAGCTACATAAATCTCAACTCGGCCTGCTCCACATCCA
GCATGAATATGGGCTATCCCAGCGCAGGTCTCAACAGCAG
CCCATTATCCAGCATGGGTGGAGGCCCCAACCACATGAGC
CTGTCCCCCGTAGGCTCCTCTCTGAACCCCAGCTCTCTGA
CTCAGCTAGGCTCATCTGCCTCCACACTGGGTCCCCTCTC
TCATTACCAAAGCATGGGTCAGCCAATGTCCCAGATCAGC
TACCCCTCTCCTACCTCACTTAACCGGACTAAGGAGATGC
CAAAGCCCTACCGTCGCTCGCTGACCCACGCCAAGCCACC
ATACTCCTACATCTCCCTCATCACCATGGCCATCCAGCAG
TCACAAAGCAAGATGCTCACCCTCAACGAAATCTACCAGT
GGATCATGGATCTGTTTCCGTATTACCGTGAAAACCAGCA
GCGCTGGCAGAACTCCATCCGCCACTCTCTATCCTTCAAC
GATTGCTTCGTCAAAGTGGCACGTTCGCCCGACAAGCCTG
GGAAAGGCTCCTACTGGGCGCTGCATCCCAATTCTGGCAA
CATGTTTGAGAACGGCTGCTACCTCCGGCGCCAGAAGCGC
TTTAAAATTGAGGAAAAAGCTGGGAAAAAGAGCTCATCAA
AGTCTCAGGATGGCAGCAGCACCAAGGGCACCCACAGCAG
CGAGGGGATGCAGGAGGAGCACAGTCCCACCACCGGCTCT
GATGGGGCTGAATCTGCCCATTCCGACAGCTCCCATGCTG
GATCCACCTCAGAGGAGCAGCAGAGGAGCCTAGTGCAGCT
GGATTGCCCATCGCAAGCTCCAAATCTTTCACACAGCTCT
CCAGTGCCGATCCCATCATCAGTGCCCTCCTCAATGCCTC
CATCCAGCTCACACCTGCACTCTCAGGGAATGGGCAACAG
CCCTCACCTGCTAGGCAGCCCCATGCACCATCTGGATCTG
CAGAACGACCCGCTGAAGTCAATGGACCCCCACTTCAATT
TCAACCATCCGTTCTCCATCACCAATCTCATGTCCAACGA
GCAGAAGATGGACCTCAAGTCGTACCAGGACCAGGTGATG
GCCTACAACAGCTACGCCACGTCCTCTCCAGTGGCCGCCA
AACAGATCTATGACAATGCAGGTCCGTCCGCCATTGACTC
TGGTGCCTACTACCAGACCCTCTACAGCAGGTCTGTCCTC
AATGCATCCTAATGTGTTTACCAGCCAGTTGAACTCTACA
GACTGTTAATGGCAGGACATCTTCAACACGGAGCTTGCTT
TGGCCTCAATAACTTTGGTTCCTGCGCTCTTAAAATTAAA
GGTTCTAAAGGGGGTTTTGCAGGGATGCCAGTGATAGTTC
CTCGACTATTGTTTAAAAATGTAAAGATCCTTGAGTCTTT
TGTGGAGTTTAAAGGTGATGTTGGAAGTTCTTTATTATAT
TGAAGAGCCTTTACCTTTAAGAGTGTTCTGAGAAAAAGAA
ATGCTTCAAGGATTGCGTCCTAATGCTATGTCTAATTTAA
TGATCATATATTCAGGAGCTAAATGTTTCGGATGTAACAG
GAAGGTGTATGCAAATGATGCCATGTGTATATATTGTTTT
GGGGAAGCAGGAGTCAGGCATTTATTTATGAAGGGAAGAA
TTTAATATATCTTGTATGATTTTGTGTCGTGAAGTTATGT
AAACAATGTGATAATAAGAGGACGTTAGCATGATTGCGGA
AGCGTTTGAGTTCAGGTTACTGCTGTGAGCAGGTGTTACT
GTGTTACAGGGAAACTCTCCTGTTTTGTGTTACAGCATAA
CGCGTGTTCAGCTCAAGTGCACTAGCATACAGTGCGCTTG
GAAGGAGAGTGTGTATCATTTTGCTTGTCCTTTTGAGAAG
CTGAAGAAATTACTTTTTTTTTTTTTTTTTACTCTTGGCC
ATGAAGTTTTTTTTGTATATTCTAAAGATATTTGTGTTAA
GTATATATATATATATAAGTTTGACCAAGACTGTGGTAAA
TCCAGCTGTTTGTTTTCCAGACTTCCCGTTTTAGAAATAC
TGTTATTCCAGTGTGCTACAGTACATGCTCAGCTTAGGCT
GTTTGTAAGATCAGCAGACAATGCACTGGGCCATTTCCAT
ACAATCCTTTGCACTAGTGACCTCTCTGTTCTTCACTGAT
GGGGAGGGGGGGAGATCATTTTGTTACAACAAAGCTTTGT
AACTACCTTTTTATCAGACAATTACACAGACCCTAATGAA
ATTGCCATGATGTATTTTTGTAAGATGTCGTCATTTTAAA
AATATCCTTCAGCAGTTTTAATAAAAAAAAAACTTTGTCT
CAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations