header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3269
Transcript Name: ptx3a-201
Previous Names: ptx3a-001, si:ch211-272f3.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016019 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016019|OTTDARG00000013483|ZDB-GENE-030131-8720 ptx3a|OTTDARP00000013593 CH211-272F3.3-001 LG_ BX255887.8 Danio rerio protein_coding NOVEL, 2164 bp
CAAGCAGGAGTCCAGCCAACAAATTGCTCAGCATCTAACA
AGGAGGACCATCCAAGAGGACAAAGACAATTATACACAAA
AGCTGAGTCTTGCTCATATTAACACATGGCCAGCAAGTCC
ATGCGGACATTCCTCCAGACCATGTGTCTGGTGGCTTCAT
TGTCCATGGCGGTATCTGACAATTATGACGATGATATCGA
AGTGGGCTTTGGACACAATTATTTTAATGAAATACCTGAT
GAGGACCAGTTGGAAGACGAGACCCCCACACCGTCCCCTG
AACCCTGCAAAAATACAGCCTTTACCAAATGGGATAAGCT
CTTCACAATGCTGGAAAATTCCCAAATGAAAGAAAACATG
CTCCTGCAGTACGCCGATGATATCATCAAGGTGGAGCTGC
AGAATCTGAGAGGAGAGATGATACAGTTTGTGGCGCAGTA
TGGTGGATCTTGCGCATCTGCAGTTGAGAGCTCGGTTCGA
CGGGCCGGGACTCAAACAGAGTCGCGCCTGCAGAACGCAC
TGGACCGTGCGCGAGAGGTTTCAGCTGATCGGTACGAGCA
GCATGATGCAGTCCTGCAGCAGCTACTGGCAGTCAGCGTA
AACCAGGCCGCACAGCTGGATCGGCTGGAGAAGGGCTGCT
TGAAATCGGGGGCTTTCAAAAACATCCAAACTCGACATCT
CATGCAGGATGTGACAGAGACAGAGAATGGTGGGAAGTTG
GAAAAGAGTCTGGAAACCATTTCCAGTGAGCTGCAAAGCA
TCCGGGAACAGCTGAGCCTTTACACCAGATCAGCTTTTGC
TGATAAGCTTCCATCAGGATGTGACACTGGACTGCTCTTC
CCCACACGTTCATCTAAAGCTCATGCTGAAGTCTCGCCCC
ATGGATTGCTTAGGACCAATGCAGTCACCATCTGCCTTTG
GGTGAAACCAACTCAGGTCTTCAACAAGACCCTCCTCTTT
TCGTACAGCACAACTGGCAATGCCTACGAACTCCAGTTGG
TGTTGAGTGGACAGAGTGCATCATTTACTGTAGATGGTGA
AAGCCATTTGGTGGAAGCTTCAGGAGCAGTGCAAGAGGGT
CAGTGGGGGCACCTTTGTGCGTCCTGGAGCTCACAACAGG
GCTTGGCCTCTTTGTGGGTGAACGGTCAACAAGCTGCAAG
CTCCCCCGGTGTAGCTGAGGGTCATGAATTACGCAGCAAA
GGAAGTATCCTTCTTGGACAAGAGTATGGACGTCACTATA
AGCATCTCAGTACACCCGACACATTTGACGCAGAGTTGGC
CTTCACAGGGAAGATGACCGGAGTAAACATGTGGGACCGT
GTTTTGGATCCAAAAGAGGTTTCTCAACAGGCCAGGCTGT
ATGGGACTGCTTGTGGTATCCGTGGTAATGTTGTGGCATG
GGGTGTGTCTGACATTCAGCCAAAAGAGGGTGTCAAGTTG
TTATACTAATTTGTGTACTTAACCCACTTCAACACCCTGA
GCCCTGCACACCAATCAGCTGCCAAGCAAGCATTGTGTTG
TGTTTAAAAGAAGTCTAGTAGTCATCAAATAGATGTGGCT
AAAACAAGGCTAAATTTGGGAAAATCTAATAGGCGTCCAA
AAATAGACTAGGAACCAAATAGACAAGAATGAATGACTAC
ACATTTCAAGTGTGTATAATCTGACTATTTGATGACTAGT
TTATTTTTGGACTATTGTAAGACGTCTATTAGATTTTCAC
TGACAGCCCAAATTTTGCCTTGTTTTAACAAAGATGTCTA
TCCAAGCAGGCACAGGACGTCAAGATTGACGTTGTACCCC
AACGTTGTGGGACGTTGCATTTTCTTTGGGAACGAAAAGC
AGCTTGACGAAACACAACGCCAGGCCGAAGTCAATGTCCA
CCATTGGACAGACGTTGCGTTTCAGTTACTTTCCAATGCA
ACCTAAAATAACAAAACATTAACATCTAATGATGTTACAT
CTTGATGTTATGTGGATGTTACCAATATGATGTCTATCAG
ATGGATTTTGGTTGCCATATCTGATGAATAAATGTCAGTA
TATGACATCAATATGACATTGCTTTAAGATCTTGGCAAGA
CTTTGGTCACTTTCCACCACAACCTAAAATAAACCAAATT
TCAAAGTAATTTCAATAATAAAATAACATTTTCCTTAGAT
GCTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptx3a-201 Contained in:

OTHER ptx3a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000016019 (1)
  • Ensembl_Trans:ENSDART00000098673 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK024613 (1) 725 bp
    GenBank:BQ132140 (1) 550 bp
    GenBank:AI331113 (1) 442 bp
    GenBank:AL922224 (1) 393 bp
    CITATIONS (2)