Transcript

tmod2-201

ID
ZDB-TSCRIPT-090929-3258
Name
tmod2-201
Previous Names
  • tmod2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000015950 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000015950|OTTDARG00000013431|ZDB-GENE-040912-185 tmod2|OTTDARP00000013542 CH211-12A1.6-001 LG_none CU469535.6,BX927313.11 Danio rerio protein_coding KNOWN, 1476 bp
GGGCTGAGACAGTGAAGACGGCTGCGGGAATTTCTTAGCC
TTCCGACCAGGAATAGGACACTAAAGAGTAAAACGCGTGC
AGGAATTTCTCTAAGGTGCTCAATCAAACTGGACTGCAGT
CTCTCCTTGACAGACGGTGTACATCATGGCTCTTCCTTTT
AAGAAAGATCTGGAGAAGTATAAGGAGATCGATGAGGATG
AGATTCTGAATAAACTGTCAGAGGAGGAGCTCAAGCAACT
GGAGAGCGCACTTGAGGAGATCGACCCTGAGAATGCTTTG
CTGCCAGCCGGACTTAGGCAGAAGGACCAGACGTCAAAAA
CAGACACCGGCCCTTTTAACCGTGACAAACTTTTGCAGTA
TTTGGAGAAAGAGGCTTTGGACTATAAAGAGAGAGAAGAC
ATTGTCCCCTTCACTGGAGAGAAAAAAGGAAAAGTATGGA
TTCCCAAACAAAAACCAATCCAGCTTCATCAGGAGGAAGC
CACAACCTTGGACCCCGAGTTGGAAGAGGCTCTGTCCAGT
GCTACTGACACAGAACTGCATGACCTGGCAGCTATTCTTG
GAGTGAACACACTGGTGACAAGCACGCAGAGTTATGACGG
CAGTAAAGACGGTTATAACAATGTCATTAAAGGAGAAAAG
GTAAAGCCTGTTTTTGATGAACCTCCAAACCCTACAAACG
TTGAAGAAAGTCTGCAGAGGATAAAGGCCAATGATCCCAC
GTTGACTGAAGTCAATCTCAACAACATCAAGAACATTCCA
ATCCCGACCCTGAAGGAGCTTGCGAAAGCCATGGAGAGGA
ACACTCATGTGAAGAAGTTCAGTCTGGCTGCCACCAGGAG
CAATGACCCTGTTGCTGTGGCGTTCTCAGACATGCTGCGA
GAAAATAAGACGCTAAGGAGTTTGAATTTGGAGTCTAATT
TCATCACCGGTGCAGGAGTTCAGGCTCTTGTAGAAGCTCT
TCGAGACAACGACACGCTTTCAGAGATCAAGATCGACAAC
CAGCGGCAGCAGCTCGGTACGTCGGCTGAGATGGAGATCG
CGAAGATGCTGGAACAGAATACAAGCATCGTGAAGTTTGG
GTACCACTTCACCCAGCAGGGTCCCAGATCCCGCGCCGCT
GCCGCAATCACAAAAAACAACGACCTGGTGCGACGGAGGC
GAGTCGAGAGGGATGTTTAAAGCATATTCCACTCTCGCTT
TCTCTCTCTCGGCTGATCAGACTCTTGTGCCAAACCCTCT
GAGGGAGACGCTTCACCTGAAGAAGGGACACAACTGGATA
CTTTGCCTCCCTAATGTTAATACTCTTATACTTTTTTTTG
GTTATGTATTATCATTGATGTTATAATTGCTGTTTGTTTT
AATAGCTGCTACTCTTGTGCAGCTCTTTTTGTTGTTGTTG
TTTGGTTCATGTCTGCTCTATTCTTTGTAAAAGTTCTTTG
AAACGAAACAGAAGACGGTTAATCACTCGCACACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations