header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3258
Transcript Name: tmod2-201
Previous Name: tmod2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000015950 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000015950|OTTDARG00000013431|ZDB-GENE-040912-185 tmod2|OTTDARP00000013542 CH211-12A1.6-001 LG_none CU469535.6,BX927313.11 Danio rerio protein_coding KNOWN, 1476 bp
GGGCTGAGACAGTGAAGACGGCTGCGGGAATTTCTTAGCC
TTCCGACCAGGAATAGGACACTAAAGAGTAAAACGCGTGC
AGGAATTTCTCTAAGGTGCTCAATCAAACTGGACTGCAGT
CTCTCCTTGACAGACGGTGTACATCATGGCTCTTCCTTTT
AAGAAAGATCTGGAGAAGTATAAGGAGATCGATGAGGATG
AGATTCTGAATAAACTGTCAGAGGAGGAGCTCAAGCAACT
GGAGAGCGCACTTGAGGAGATCGACCCTGAGAATGCTTTG
CTGCCAGCCGGACTTAGGCAGAAGGACCAGACGTCAAAAA
CAGACACCGGCCCTTTTAACCGTGACAAACTTTTGCAGTA
TTTGGAGAAAGAGGCTTTGGACTATAAAGAGAGAGAAGAC
ATTGTCCCCTTCACTGGAGAGAAAAAAGGAAAAGTATGGA
TTCCCAAACAAAAACCAATCCAGCTTCATCAGGAGGAAGC
CACAACCTTGGACCCCGAGTTGGAAGAGGCTCTGTCCAGT
GCTACTGACACAGAACTGCATGACCTGGCAGCTATTCTTG
GAGTGAACACACTGGTGACAAGCACGCAGAGTTATGACGG
CAGTAAAGACGGTTATAACAATGTCATTAAAGGAGAAAAG
GTAAAGCCTGTTTTTGATGAACCTCCAAACCCTACAAACG
TTGAAGAAAGTCTGCAGAGGATAAAGGCCAATGATCCCAC
GTTGACTGAAGTCAATCTCAACAACATCAAGAACATTCCA
ATCCCGACCCTGAAGGAGCTTGCGAAAGCCATGGAGAGGA
ACACTCATGTGAAGAAGTTCAGTCTGGCTGCCACCAGGAG
CAATGACCCTGTTGCTGTGGCGTTCTCAGACATGCTGCGA
GAAAATAAGACGCTAAGGAGTTTGAATTTGGAGTCTAATT
TCATCACCGGTGCAGGAGTTCAGGCTCTTGTAGAAGCTCT
TCGAGACAACGACACGCTTTCAGAGATCAAGATCGACAAC
CAGCGGCAGCAGCTCGGTACGTCGGCTGAGATGGAGATCG
CGAAGATGCTGGAACAGAATACAAGCATCGTGAAGTTTGG
GTACCACTTCACCCAGCAGGGTCCCAGATCCCGCGCCGCT
GCCGCAATCACAAAAAACAACGACCTGGTGCGACGGAGGC
GAGTCGAGAGGGATGTTTAAAGCATATTCCACTCTCGCTT
TCTCTCTCTCGGCTGATCAGACTCTTGTGCCAAACCCTCT
GAGGGAGACGCTTCACCTGAAGAAGGGACACAACTGGATA
CTTTGCCTCCCTAATGTTAATACTCTTATACTTTTTTTTG
GTTATGTATTATCATTGATGTTATAATTGCTGTTTGTTTT
AATAGCTGCTACTCTTGTGCAGCTCTTTTTGTTGTTGTTG
TTTGGTTCATGTCTGCTCTATTCTTTGTAAAAGTTCTTTG
AAACGAAACAGAAGACGGTTAATCACTCGCACACAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmod2-201 Contained in:
OTHER tmod2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000015950 (1)
  • Ensembl_Trans:ENSDART00000012164 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC081555 (1) 1488bp
    GenBank:BQ285194 (1) 678bp
    CITATIONS (2)