header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3255
Transcript Name: cyp19a1a-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: artifact
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000015937 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000015937|OTTDARG00000013418|ZDB-GENE-990415-43 cyp19a1a|no_translation cyp19a1a-002 LG_ BX908722.4 Danio rerio protein_coding KNOWN, 1673 bp
CGTTCTTATGGCAGGTGATCTGCTCCAGCCCTGTGGAATG
AAGCCGGTGCGTCTCGGCGAGGCTGTGGTGGATCTTCTTA
TCCAAAGGGCTCATAACGGCACTGAAAGGGCTCAGGACAA
TGCGTGTGGAGCTACAGCTACAATACTGCTGCTGCTACTC
TGCCTGCTGCTGGCCATCAGACACCATCGACCACACAAAT
CACACATTCCAGGTCCTTCTTTCTTTTTTGGTCTGGGTCC
TGTTGTCTCCTACTGTCGGTTCATCTGGTCTGGGATCGGG
ACTGCCAGCAACTACTACAACAGCAAGTATGGAGACATTG
TGCGTGTCTGGATCAATGGTGAGGAAACTCTCATCTTGAG
CAGGTCGTCAGCTGTATATCACGTGTTAAGGAAGTCTTTG
TACACTTCACGCTTTGGAAGTAAACTGGGTCTGCAGTGCA
TCGGGATGCATGAGCAGGGCATCATATTCAACTCAAATGT
GGCTCTCTGGAAGAAAGTCCGTGCATTTTATGCTAAAGCT
CTCACAGGTCCAGGGCTTCAGAGGACTATGGAGATCTGCA
CCACCTCCACAAACTCTCACCTGGACGATTTGTCTCAGCT
GACGGATGCTCAAGGACAGCTGGACATTCTTAACTTACTG
CGATGCATCGTGGTGGACGTTTCCAACAGACTGTTTCTAG
GAGTCCCGCTCAATGAGCACGATCTGCTTCAGAAGATTCA
TAAATACTTTGACACCTGGCAGAAGAAAGTTCAACTGGCA
CACGCAGAGAAACTTGACCACCTCGACTTTACAGCAGAGC
TGATATTTGCTCAGAGCCATGGAGAGCTGAGCGCAGAGAA
CGTCAGGCAGTGTGTGTTGGAGATGGTGATCGCGGCTCCA
GACACTCTCTCCATCAGTCTGTTCTTCATGCTGCTGTTAT
TAAAACAAAATCCAGATGTCGAGTTAAAGATCCTGCAGGA
AATGGACAGTGTTTTAGCTGGCCAGAGCCTCCAGCACTCG
CATCTGTCCAAGCTGCAGATCCTGGAGAGTTTTATCAACG
AGTCTCTACGTTTTCACCCGGTCGTGGACTTCACCATGCG
GCGGGCGCTGGATGATGATGTCATCGAGGGCTACAACGTG
AAGAAAGGAACAAACATCATACTGAATGTGGGTCGAATGC
ACAGATCCGAATTCTTCTCCAAACCCAATCAGTTCAGTCT
TGACAACTTCCATAAAAATGTTCCGAGTCGTTTCTTCCAG
CCGTTCGGATCGGGTCCTCGGTCGTGTGTGGGGAAGCACA
TTGCCATGGTGATGATGAAGTCTATTCTGGTGGCTCTGCT
GTCTCGTTTCTCCGTGTGTCCTATGAAGGCCTGTACAGTA
GAAAACATCCCGCAAACCAACAACCTGTCGCAGCAGCCGG
TGGAGGAGCCGTCCAGCCTCAGCGTGCAGCTTATCCTCAG
AAACACTCTCTGATCCACACACACTCATTCGCCATCACAT
ATTTATCTACTGCTTCTGCTTTTGGATATTTGTTGAAATG
TGTACTTCAGTGTGAATGTAACATATTGCTTTGATGTATG
ATATTGTGATTGTCTGTTAATTTCTGTAACTAAATGTAAC
TATTATAATGTATGATTTTGTGACTTAATTTCTGTAACCT
TTTTTTATTGTTAATAAAAGTATTCAAATTTGA

cyp19a1a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA cyp19a1a-002 1673
mRNA cyp19a1a-201 (1) 1862
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyp19a1a-002 Contained in:
OTHER cyp19a1a-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000015937 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF183907 (1) 1701bp
    CITATIONS (1)