Transcript

capn12-201

ID
ZDB-TSCRIPT-090929-3200
Name
capn12-201
Previous Names
  • capn12-001
  • si:ch211-160d20.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000015806 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000015806|OTTDARG00000013318|ZDB-GENE-050419-245 capn12|OTTDARP00000013425 CH211-160D20.1-001 LG_none BX927074.16,BX248121.9 Danio rerio protein_coding NOVEL, 2383 bp
ACACAAGTTTTGTCAAACAGTCCTGACGCATCTGATCCTC
TCTAGTGACCTGAAGAGATGTCTGAATTAGGCTCCATTGA
CAATCCGGTCAAGTTCAAGGATCAAGACTATGAAGTCCTG
CTGCAGACGTGCCTCAAATCCGCAGTTCTGTTCTCAGACT
CGGTGTTTGCAGCGAATCAAAGCTCCCTCGGTCTCCCAGC
GGATCCAGATCCCAAGAAGGCAGTGAAGTGGCTGCGCCCT
AAGGAAATCACCAGCAATGCCGTCTTTGTGGAAGGCACCA
TGGGCACCACCGATATCTGCCAGGGCCAGCTGGGTAACTG
CTGGCTGTTGGCGGCCCTGTCCTGTCTCACCATGCATCCA
ACTCTATTTGTGAAAGTGGTTCCAGCTGGACAAAGCCTGA
GTGAATCCTACGCTGGCATCTTCCGATTTAAGTTCTGGCA
GTATGGTGAGTGGGTGGAGGTGGTAGTGGATGACAGGCTG
CCTGTGAGAGAGGGCCGTCTGCTTTTCAGCTACTCTCGCA
CCAGCAACGAGTTCTGGAGCGCCCTGGTGGAGAAAGCTTA
TGCCAAGCTGATTGGTTCTTATGGCAGTCTAAAGGGCGGG
ATTATCTCAGAAGGAATGGAGGATTTTACAGGAGGAATTG
CGTACTCTCTTCCGGTGTCTTCGCGACCCCCGCGCATGCT
CTGGAAAGCCATCACCGCAGCCCTGGCCCGGAACAGCCTG
CTAAGCTGCTTCATTCATGCCACCACTGTGAAGGACATTG
GCACTGTGACCCCAGAGGGTCTCATCAAAGGTCATGCCTA
TGCCATCACTGAAACAGGCAAGGTCAAGAAGGCTTCTGAA
GAGGTCTTTCTGCTGAGACTGCGTAACCCCTGGGGATTTG
TTGAGTACTGCGGACCCTGGAGTGACAAGTGTAAAGACTG
GGACTTCGTAGACAACACTGAGAAGACGAAACTTGAATTG
GCCAAAGTTGAAGATGGAGAATTCTGGATTAGCATAGAGG
ACTTTTGCAGATTTTATAATACAGTGGAGATGTGCAGTGT
GGATCCAGACTCTATGTCGGGGGAAGAGAGTGAAGATACA
AGCACCTCGTCCTGGACACTGAGCTTACATCAGGGAACCT
GGGTCCCAATGTGCTCTGCTGGCGGCAGCCGACGATACCC
AAAATCTTTCTGGAAAAACCCTCAGTATCAGATGATTCTG
TCTGAGAAAGATGTGGATGATCACGATTATGGAGAGGGAG
AGAAAAAGAAGAAGTGCACAGTGCTGGTGGAGCTTCTCCA
GAAGTACCGCAGACAAAAAGATAAAGTCAACTTCCTCTAC
ATCGCGTTTCATATCTATAAGCTGAAGGACAGCCCTGGAT
CTCTGGATCAGCAGTTCTTCTCCAGCAACCGTGCGATTTC
TCGCTCCGGCAAGTACCGCAGCATCAGGAGCGTCTGGAGG
AAAGTTCACCTGGAGCCCGGCAGTTACGTCATCCTGGCCT
CCACTTACAGACCCAACCAGCAGGGGGAGTTTTTCCTCCG
CATTTACACCAAAACTGGCAACATACAAGGCTTTCAGGAT
TTCCCCTGCACCAACAACTACTCTGCGATGGTAATGTCAA
AGCCAGTCTTACCTGAGGATCAGTACAGGGTGCAGAAGTG
GTTTGAGGAAAAGGCTGGATCGGATGAGAGAGTGAATGCT
GTGCAGTTTATGAATCTGGTAAACTCAGTGTTGGAAAAAG
ACTATGAACTTCCTCTGGAGACCTGCAGACAGCTCATCTT
TGGAGAAGATACTGGTGGCCGAGGCCGTCTGGACCGAGCT
CAAGCAGAGAAGCTGCTCTCCTCCCTCCGCAATCTGCAGT
CCATCTTTTTTCAGTTTGATGAAGATTCATCAGGAACTAT
GAGTCCGTTTGAGCTCAGTTTGGCTCTGAATGCTGCAGGT
GTGGAGTGTGACAGCGTTGTGGTGCAGATGTTGTGGGAAA
GGTTTGGCGCTGGTGAACAGTACCTGCCCTTCTATGGCTT
TGTGTCTTGTGTTGCCAGACTCCAGGTGCTCTTTGATCTT
TACGAAGCGGAAACCAACCAGGAGGTGAAGGACAAGGGCA
TCAACGCTTGGCTGCTCAAGCTGTTGGCTGTGTGAGTCGT
CCAGACCCGACACCTCAGCGGGACAGACCTGCTAGGCCAA
GCCTGCTCTGACGTCACCCACCTGGGCCTGCGTCTTTTAC
ATGTCCCCCCTCTTCTGTCTCATTTGTGATCTGCGGACCT
TTGCCCTGCAGTTGCATCCACCCACTCACTGCTCTATCAG
TTGGGGTCTAGTATAGCCATGTAGGTCATTACTGCCTGGA
TACAAACCATTTCGGCATTTTGTTTCACTCAACCCCACCC
AAACACAATGTGTGGGTGTTTAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations