header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3171
Transcript Name: dusp22a-201
Previous Name: dusp22a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000015729 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000015729|OTTDARG00000013250|ZDB-GENE-040718-219 dusp22a|OTTDARP00000013354 dusp22-001 LG_none BX548023.3,BX890541.5 Danio rerio protein_coding KNOWN, 1308 bp
TCGGCAGAATTCCGGAAGCTGTCACACCGACTGTTTTCTT
CTGTGAGCTTACTGAATATAATTAGACTTTTACTATTGAA
CGCAGTCGTTTTCGAGCCGCATGTCGATTCTCTGATGCAA
TGAACATTCTGAGGTCTGTTTGCACGTAAACTTAACAGTC
GTTCCTGACAAATAACCATGGGGAATGGAATGAATAAGGT
CATTGATGGTCTCTATCTAGGAAATATAAGAGATTCAGAG
AACAGAGACAGTCTGTCCCGCAATGGCATCACCCATATCC
TCTCCGTCTGCAACAATGCAAAGCCTGTGTTAGAGGATAT
GACCTATCTGTGCATTAATGCAGCTGATGCCTCCAGTCAA
AACTTATCTCAACACTTCAAAGAATCCATACGCTTTATCC
ATGAGTGTCGACTTAATGGAGGGGCATGTCTAGTTCATTG
TCTTGCTGGAGTGTCTCGGAGTACCACTGTGGTGGTGGCT
TACCTCATGACAGTCACCAGCTATGGCTGGCAAGAGTGTC
TTACTGCGGTGAAGGCTGTGCGCTCTTTTGTGGGCCCAAA
CTATGGCTTCCAGCAGCAGCTGCAGGAGTTTCAGATGAAA
CAGGTGTCAGAGTATCAGGCATGGTTGCGGGCCAGCTATA
GATCCAGCCCATTTAAAGACCAGGAACAGGTTGAAGCTTT
ACTGAGTCTGTTTGCAGAACAGCAGCAACAAGGACAACAA
AATGATCCGGAGTGGATGAGCCAGGGCTCTCGCATCTATC
CTCTGTCCTACAACCAATACAGTGCCTCGGGCAGCAACAG
GTGAAAGCAGACTTGACCAGGTCTCCGCTGCCCACCAGAT
TTACACCCTGAAAGGACTAAAAGAGCATGTGTGGCAATTC
CCACATGTGCAGATCATTTCAAAAGAGAGATCATAGAACA
CTTTAGATTACAGTCATGCTGATGTGAGCATTATGAAAAC
GGTAATAGCGAGTTCATTAACCATTGATCACTCAAAGAGT
ATTTTTTCCTTTATAAGTTGTTGGAATCTGATAGAGTTAG
TCGCCAGCATTGCTGTATTTTTAAAAAAACGCATCCCCCA
CTGCTCTACCTCCAAAATGATAAGGATGCCTTTAGATCTT
TTAGTTGTCCGACATTAGATTGATAATAGATCAGTGCTAA
AATGCTCTAAGCGCATAAATTGCTTTATAAAATGCAGTAT
TTGGACCGCTAATGTGTAATTTATGCTTTGTATTTCATAT
ACTGTATATTGTACTGTTGGTCTCTCTTGGCATAAAACGT
GGCAATAAAGTAATAAAACAATTTAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dusp22a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000015729 (1),  Ensembl_Trans:ENSDART00000078888 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC076284 (1) 1321 bp
GenBank:CK396986 (1) 807 bp
GenBank:BI984580 (1) 585 bp
GenBank:AI545128 (1) 319 bp
GenBank:AA494835 (1) 302 bp
CITATIONS (2)