ZFIN ID: ZDB-TSCRIPT-090929-3167
Transcript Name: foxf1-201
Previous Name: foxf1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000015723 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000015723|OTTDARG00000013245|ZDB-GENE-050419-153 foxf1|OTTDARP00000013349 DKEY-199I24.2-001 LG_ FO834814.1 Danio rerio protein_coding NOVEL, 1383 bp
GATAAGTAAAAGCCCAACTCCTAAAGGAAGGACAAGAAGA
CTGGATCTCGATAGGAAGCCGAATGAATCTTTTCCCTGCT
GTGTTCAGTTTTATGTTGAGTAGTGCTTAGACAGTAGGCC
AGTGTGAAATTACGTACAAAGAAAGAACTTAAAGCAGCGC
AGTCCGTTTCTAATGATAAAAGTTTAGAAACTTAAGTTTT
TTTTTCATCGTGGATTTTGACGTGCGCGTAAACGTGAAGA
ATGACGGCTGAAGTGCAGCAACCCTCTGTGCAGACCCCCG
CTCACAGTAGCCCCATGACGGAGAAACCCGTCCAGACGCC
TGTGATGGAGACCTCCTCTTCCTCCTCAAGCACGAAAGCA
AAAAAGACCAACGCTGGAATTCGTCGTCCCGAAAAGCCCC
CGTATTCTTACATCGCTCTTATTGTCATGGCCATCCAGAG
CTCTCCAACCAAACGACTCACTTTAAGCGAAATTTATCAG
TTCCTCCAGAGCCGCTTCCCATTTTTTAGAGGATCGTATC
AGGGCTGGAAAAACTCTGTGCGTCACAATCTGTCTCTGAA
TGAATGCTTCATCAAGCTACCCAAGGGTCTAGGCAGACCT
GGAAAGGGTCACTACTGGACCATCGACCCAGCCAGTGAGT
TCATGTTTGAGGAGGGATCCTTCCGCAGGAGGCCGCGGGG
ATTCAGACGCAAATGCCAGGCGCTCAAACCTTCCATGTAC
AGCATGATGAACGGGCTGGGATTCAATCACATACCCGAGT
CCTATAACTTTCAGGGGGGCGGCGGGGGCCTGTCTTGTCC
TCCAAACAGTTTATCTTTGGAGAGTGGAATTGGGATGATG
AATGGACATTTGGCTAGCAATATGGAAGGAATGGGCTTGG
CAGGACACTCTATGCCCCATCTATCAACGAATAGTGGACA
TTCCTATATGGGCAGTTGCACGGGATCATCAGGGACGGAG
TACCCCCACCACGACAGTTCCGCATCGCCGCTTCTCACCA
GCGGGGGGGTGATGGACCCGCATGCCGTGTATTCTAGCAC
GGCCTCGGCCTGGCCTTCAGCGCCCCCGACATCTCTAAAT
AACGGGACGTCCTACATTAAACAGCAACCGCTCTCTCCGT
GCAATCCCGGTGCCAGTTCATTGCAGCCCAGTTTACCAAC
ACACTCTTTGGAACAGTCCTATTTGCATCAGAACGGTCAC
GGTACCACCGACCTCCAAGGTATACCGCGCTATCATACCC
AATCTCCCAGCATGTGTGACAGGAAAGAATTTGTCTTTTC
TTTTAACGCCATGACCTCTTCATCGATGCATTCACCAGGG
AGCAGCTCGTACTACCACCATCAACAGGTCTCTTATCAGG
ACATCAAACCTTGTGTGATGTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
foxf1-201 Contained in:
OTHER foxf1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000015723 (1)
  • Ensembl_Trans:ENSDART00000012374 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CD756587 (1) 882bp
    CITATIONS (2)