ZFIN ID: ZDB-TSCRIPT-090929-3092
Transcript Name: slc12a3-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000015396 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000015396|OTTDARG00000012991|ZDB-GENE-030131-9505 slc12a3|no_translation slc12a3-002 LG_ BX470170.5 Danio rerio protein_coding KNOWN, 560 bp
ATGAACCTCCAAAGCGCAAGAAGCCCATTTTCAGTCTCCT
CGCTGAGCAATGGAGACGACCGTAAGTTCAGTTTGGGTGG
ATGTAGCAGTTATGACACTGACAGCGTGGCCTCACGCAGC
TCTGGTGTCTTTTCTGGATATGACACGCTGGATGCACCAC
CGAGTTACGACTTCTACACCAACACTGAGGTTTTCGGGAG
AGCCAAGAAATCCAGACCATCTCTCTTTGAGCTGCACTCC
AACCCTCAGGTACAGTAGGAATGACTTACCTGTACAATAT
TATCATTCCAATATTGTAAGGAAAGTCAGTGATGATTCCA
CAAAGGAAGGGACTTTTATTATTATTGTTTTTATTTGTGT
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCAGGATGACC
CCTCTCCACCTCCCCTGTATGAGGAGTCCAGTGTGGACAA
ACAGAGTCCAGAGGATGAAGATGAGCCCACTGAACCACCT
CCAGAACCCGCTCGCTTTGGATGGGCTCAAGGAGTTATGA
TCCGCTGTATGCTGAATATCTGGGGTGTCATTCTGTACCT

slc12a3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slc12a3-201 (1)    Ensembl 3792
ncRNA slc12a3-002 560
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc12a3-002 Contained in:
[BAC] CH211-122C9 (1)

Genome Resources: Vega_Trans:OTTDART00000015396 (1),  Ensembl_Trans:ENSDART00000145340 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BG729285 (1) 560 nt
CITATIONS (2)