ZFIN ID: ZDB-TSCRIPT-090929-3091
Transcript Name: slc12a3-201
Previous Name: slc12a3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000015395 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000015395|OTTDARG00000012991|ZDB-GENE-030131-9505 slc12a3|OTTDARP00000013069 slc12a3-001 LG_ BX470170.5 Danio rerio protein_coding KNOWN, 3792 bp
CGGGATGAACCTCCAAAGCGCAAGAAGCCCATTTTCAGTC
TCCTCGCTGAGCAATGGAGACGACCGTAAGTTCAGTTTGG
GTGGATGTAGCAGTTATGACACTGACAGCGTGGCCTCACG
CAGCTCTGGTGTCTTTTCTGGATATGACACGCTGGATGCA
CCACCGAGTTACGACTTCTACACCAACACTGAGGTTTTCG
GGAGAGCCAAGAAATCCAGACCATCTCTCTTTGAGCTGCA
CTCCAACCCTCAGGATGACCCCTCTCCACCTCCCCTGTAT
GAGGAGTCCAGTGTGGACAAACAGAGTCCAGAGGATGAAG
ATGAGCCCACTGAACCACCTCCAGAACCCGCTCGCTTTGG
ATGGGCTCAAGGAGTTATGATCCGCTGTATGCTGAATATC
TGGGGTGTCATTCTGTACCTGAGGCTCCCCTGGATCACAG
CTCAGGCAGGGATAGGTCTGACTTGGATTATAATCTTGGT
CTCCTCCTCTATAACGGGCATAACTGGCTTGTCCACATCG
GCCATTGCTACTAATGGCAAAGTCAAAGGGGGTGGAACAT
ATTTTCTGATCTCTCGGAGTTTGGGTCCAGAACTTGGTGG
CTCGATTGGGCTTATTTTTGCTTTTGCGAATGCTGTGGCT
GTAGCCATGCACACAGTGGGATTTGCCGAAACGGTGCAGG
TACTCATGCAGGAGACTGAGGTTAGCATGGTTGACAAGCT
TAACGATATCCGCATCATCGGAGTGATCACTGTCACCTGC
CTGCTGGCCATCTCAATGGCTGGAATGGAATGGGAATCCA
AGGCCCAAGTCTTGTTCTTCTTTGTCATAATGATATCCTT
CGCCAGCTACATCATTGGAACCATCATACCAGCCACACCA
CAGAAGCAAGCCAGAGGATTTTTCAGCTACCGAGCTGATA
TTTTTGCGACAAACTTTGTGCCCGGCTGGCGTGGACCGGA
GGGCAGTTTCTTTGGCATGTTTTCCATCTTCTTCCCCTCA
GCTACAGGCATCCTTGCGGGGGCTAATATCTCCGGAGATC
TGAAGGATCCAAATGTCGCTATACCTCGTGGAACAATGCT
GGCCATTTTTTGGACCACTGTGTCTTATCTTATCATCTCA
GCTACCATTGGCTCCTGTGTGGTGCGTGATGCTTCTGGTG
ATGTGAATGACACCATATCATCATTGACTGGGGAGTGTCT
GGGAGTGGGCTGCAACTATGGCTGGAACTTTACTGACTGT
ATGACCAACAACACCTGCACTTATGGACTCAGCAACTATT
ACCAGAGTATGAGCATGGTTTCTGCAGTCGCTCCTCTGAT
CACTGCTGGGATTTTTGGAGCCACCCTTTCCTCAGCCCTA
GCCTGTCTGGTGTCCGCTCCTAAGGTTTTCCAGTGCCTTT
GCAAGGACAAACTGTATCCAGGCATTGGATTTTTCGGGAA
AGGTTATGGGAAGAATAACGAACCACTGAGAAGCTACTTG
CTAGCTTATATCATTGCTATATGCTTTATTCTTATTGCCG
AGCTGAACACCATTGCTCCCATCATTTCCAACTTTTTCCT
CTGCTCCTACGCCCTCATCAACTTCAGCTGTTTCCATGCC
TCAATAACTAACTCACCAGGCTGGCGTCCAACTTTTCGAT
TTTACAGCAAGTGGTTGTCTTTGCTGGGAGCGGTAGTGTC
TGTGATCATCATGTTTCTTCTGACCTGGTGGGCTGCTCTC
ATAGCCATTGGCATAGTCATCTTCCTGCTGGGATATGTGC
TGTATAAGAAACCTGAAGTCAACTGGGGTTCATCAATGCA
AGCCAGCTCTTATAACATGGCACTGTCCCAGTGTGTGGGT
CTTAATCAAGTGGAAGACCATATTAAAAATTACAGGCCAC
AGTGTTTGGTCCTCAGTGGGCCTCCCTGTGCGCGGCCTTC
CCTAGTGGATTTTATCGGTGCCTTCACCAAGAACCAAAGC
CTGATGATATGCGCAAATGTCCTTGCAAGTGGACCCTCGC
CTGGCACCGCAGACTCCATGAGCAGTACTCATTTAAAATG
GTTAAACAATCGGAAGATAAAGTCCTTCTACCACACCGTA
GTGGCTGATGATCTTCGTACCGGCGTACAGATGTTGCTGC
AGAGTACGGGTTTGGGTCGGATGAAGCCTAATGTCTTAGT
GATGGGATATAAAAAGAACTGGCGTAAAGTTCAACCAGGC
ATTATTGAAAACTACGTTGGAATTTTGCATGATGCATTTG
ACCTGCAATATGGTGTTTGTGTTCTTCGAATGAAGGAGGG
TCTTGACATAACTCGAACAATCCAAGCTCAAGTAAATCTA
GGATTTGAAACATCTACTGAACAAGGACTTGACACAAACT
CAACAGCTCCTACATCACCCACAATTGAAGCATCATTGGA
TCCTGAGACTCTAATGGCCCTGACGCAGCCCAGCACTTTA
TTTCAGACTAGACAAGGAAAGAAGACCATTGATGTGTATT
GGCTTTCCGATGATGGCGGTTTGACACTATTGATCCCTTA
CCTCTTGACCCGTAAGAAGCGCTGGGGAAGATGCAAAGTG
AGGGTGTTTGTTGGAGGTGAAGCTCAACAGATTGAAGAAC
AGAAAAAGGAGCTCAAAGGTCTGATCAGCAGGTTCCGTCT
GGGTTTCAAGGATATTCAAGTTCTTCCAGACATCAATGGA
GCTCCGCAGTCTGAACACATTAGAAAGTTTGAAGACTTCA
TAGCTCCGTATAGAGTAAGCTCAGTCCAAAAGGACGGCCA
AGAAGCCGATGAGGCAACAAAGGAATTCTCCTGGATGGTG
TCTGATGAGGAAATGGAGACGTTTAAAGCTAAGTCTCTTC
GACAGATCCGGCTGAATGAAGTTATTCAAGATTACTCGAG
AGATGCTGCACTGATCGTTGTGACAATGCCGGTGGGGCGA
AGAGGGTCATGTCCTAGTCCTCTTTACATGGCTTGGCTAG
AGATTGTGTCGCGTGATCTTCGACCCCCAGTCCTTCTTGT
CCGAGGCAATCAGGAGAATGTGCTGACGCAATACTGCCAG
TGATCGCCACCTTTTCCTGACAAAAACATTTACACATGTA
TAGCAGATGAAAAAAACTAGTCAATCACCTGTTAAACTGA
CGAGAGATGCTTTCATATTGTTTCATACTTGTCTTGTTGT
TTATAGGGTGCTTGTCTGAATTGGTTTAACCTTTTATTAC
CTTATTACTGTGAATATTACTCACTTTCTCCATATGCAAG
AATTCAGACAAGACTATTCAAACTATTTCCTCCTAAAACC
ACAAATTAACTGTTGTTTTAAATCACTTGAATCATTGATA
TTGATTATTGTAATGCAATGATTGAACAGTTTGCATATGT
ATATACTTTTCTCTGTTTAATGAGATCTTTTATAATATAA
TGTACATTTAAGAAACTACTTATGTATGGAATCTGTCAAC
TATAAGAGTCATTTTATTTTGCTTGAGTAAACTTGACGAA
AAATGTGTTGTCTTGTTGAAATGGTGTGTTTAGACTGTGT
GTGGCTGACCTAAATAACCATTTAAACAGAAAGCAGACAT
TTTGTGTTCTCAAACTAGCTATTTTTCCACTTTTAATCTT
TCTTTTAACGTTTTGTTAGATAACTGGTGATGTTTCACAG
TGAAGCAGGATTTAGGGGAGACGATGCAGGCAAAAACATG
AATCTCTTAAATGAATCTGTCATTTTGAGATTTTGTTTAT
TGTTTTTCAGTCTTTTGTTGCACCCTGTTCATTTGTGTGT
GGATTTCAAATAAAATACATATTTGTAGAGAC

slc12a3 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slc12a3-201 3792
ncRNA slc12a3-002 (1)    Ensembl 560
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc12a3-201 Contained in:
[BAC] CH211-122C9 (1)

Genome Resources: Vega_Trans:OTTDART00000015395 (1),  Ensembl_Trans:ENSDART00000010998 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CA473950 (1) 951 nt
GenBank:CD758896 (1) 905 nt
GenBank:CK019385 (1) 904 nt
GenBank:CA473025 (1) 894 nt
GenBank:CA787590 (1) 879 nt
GenBank:CA471967 (1) 855 nt
GenBank:CD595159 (1) 650 nt
GenBank:CD595406 (1) 650 nt
GenBank:AW419858 (1) 593 nt
GenBank:CD283867 (1) 563 nt
GenBank:AW420569 (1) 552 nt
GenBank:BG728408 (1) 542 nt
GenBank:BG883994 (1) 535 nt
GenBank:CD606354 (1) 500 nt
GenBank:CD604014 (1) 472 nt
GenBank:AL927729 (1) 431 nt
GenBank:CD602127 (1) 355 nt
CITATIONS (2)