header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-3005
Transcript Name: mlc1-202
Previous Name: mlc1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000015057 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000015057|OTTDARG00000012739|ZDB-GENE-050419-145 mlc1|OTTDARP00000012789 CH211-192N14.1-001 LG_none BX957245.8,BX649610.5 Danio rerio protein_coding NOVEL, 1177 bp
GATGCAGCGAGAGGAGGCATCGGCTCAGGAAGTGTTCAGC
TATGCCCAGATGTCCACCCTGGAGAGAAACAGCGGTGTAG
GAACGCTGAGTCGGCATCTAGAGCGCGAGCGATTGGAGAG
AGACGGCTACACGGTGGATGTCAGAGCCAGTGACCTGCAG
CTGGATCAGCCTGGCCCGCTACATCCCTGCTTCAGCTACA
GAGTCTGGCTTTACAGTGTGGTTGTAGGGAGCAGCTTGCT
GATAGCGTCGGCTTTCTCGCTCTACATGGGTAATGTGTTT
CCTGCTGCAATGGATTACCTGCGCTGTACTGCTGGATCTA
GTATACCAGCAGCAGTGGTGAGCTTCGCCATTGCCAAGAA
CAGACAAGTCGCAGTCTCAGACTTTCAACTGGTCTATGTG
TCTTCCTTTGCTGTGACAACCACGTGTCTGGTGTGGTTTG
GCTGTAAACTGGCCATCAGTCCTTCAGCCATCAATATTAA
CTTTAACCTGCTCCTGCTTATTGTGCTGGAAGTGCTCACC
GCCAGTACTGTTATTCTGTCAGCACGTTCAGTGGACAACT
GCTGCAGTCACAGCAAGCCGGTGTCTGAAGGCCCAATGAT
TGTGACCCAAACATCGTTCCCCACTCGTCTTTTCAAGGCC
TTCGCCGTAATTGAGCTCATAGTGGGCATCGCTGCAGTTT
TTGGAGGAATTATTGCCCTCAATTTGGGCGCTCTTCTCCC
AGAGCCTTACCTTTCTGTTACCTTCTTCTGGATTCTGGCA
GCGTGTTTCCCCAGTGCCATCGCCAGCCATGTGGTGGCAG
AAAATCCCAGCAAAAGTCTGGTGGAAATGCTGATTGCTAT
AAATAGTGTGACTTCACCACTGCTCTTCTCGGCCTCTGCA
TTCTTATCCAGCAGTGTGATTAGTTTTATTGAGATCTTTC
TGCACGAAGTAGCATTAGCCAAGCAGTCGTATGACATCCT
GCTGTTGGTCCTGATGCTGCTGCTGCTGGTGCCAGCGGTG
CTGACTTTAGCCACTATTATACAGTGTGCTTCCTACAAGA
GCCAGGTCCGCATGGGTGCTAACGAATGGGACACACTGCG
CAAAAAACACTGTGAGCAGCTGGCATCAAATGGCACATTA
AGGGATTTCGACAAAGAAAAGGCCTGGAAGGCAGTGGTCG
TCCAGATGGCCCAGTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mlc1-202 Contained in:
OTHER mlc1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000015057 (1)
  • Ensembl_Trans:ENSDART00000141893 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)