ZFIN ID: ZDB-TSCRIPT-090929-2927
Transcript Name: aebp2-201
Previous Name: aebp2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000014838 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000014838|OTTDARG00000012575|ZDB-GENE-040426-2885 aebp2|OTTDARP00000012638 aebp2-001 LG_ BX914207.15 Danio rerio protein_coding KNOWN, 2653 bp
GCCTCCAGCAGTTCCACGATCCGTCCGCTCACCGAAAGTC
TCCGCGTTTCACCCGTTTCCCGTCGCGTAAACCCGGCCAG
GCCGCGCACACACCAGCGGAACCCGATGGCTTCGACGACC
TCCGACGCTTCCGAGCAAGAGTCAGCGAACCCGAGCGAGA
AAAACGGCGACGGGAGCGAGTCGGGCCTGCGCGCCGCCGA
TCCGGAACCGGCCGTTAAGATGGACGAAGCGGACACGGAC
GAGAAGCCCGGTGGACACGAGCCTACAGAACAAAGCCCAG
AGGAAGCCACGCGGGACGGGGGTAATGATGAAGACGGGGA
GACCGAAAAGGAGCAGCAGAAGAGCCCCGGTAGCGCGGAC
GGGACGGCGGAGCGGATGAAGAGAGAACAAAGGGAGGAGG
AGAGCGTGTCCTTACCGGCGGAGAAAAACAGCGGCGGCGG
CGGCACCGGAATGAAGCGCCGCGCGAGCCTGGAAATGATG
AGCTCGTCTTCGGACGGAGAGCCTCTCAGCCGCATGGACT
CGGAGGACAGTATTAACAGTACTCTCATGGACACGGAGAG
CATTCCGTCCAGCGGTCGCTCTACCCCAGCTATGATGAAT
GGTCTCGGTGGGGCGTCTTCCTCCACTAAGGGCTCATCTT
ACCCCTGCTGCTGGGATCAGTGCCACATGCTGTTCAACAC
CAGCCCGGACCTGGCCGAACACATCCGCGGAGTGCATGTG
GATGGACAGCGTGGCGGGGTATTCGTGTGTCTTTGGAAGG
GCTGTAAGGTGTATAACACACCATCTACCAGTCAAAGCTG
GCTCCAGAGACACATGCTGTCACACAGCGGAGACAAACCA
TTCAAGTGTGTGGTGGGTGGTTGCAATGCCACCTTCGCCT
CCCAGGGGGGGCTAGCGCGCCATGTGCCAACCCACTTTAG
CTCCCAGAATTCCTCCAAACTTTCAAGCCAAACCAAGGTG
AAGGAAGAATCTCCTTCCAAAGCGGGCATGAACAAAAGGA
GGAAGCTCAAGTACAAGCGGCGGCGGTCTTTGCCGCGACC
GCATGACTTTTTTGATGCTCAGACTATGGATGCAATCCGT
CATCGCGCCATCTGCCTCAATCTAGCAACCCATATTGAGA
GCCAGGGCAAAGGCCACAGCGTTGTGTTTCACAGTACGGT
GATCGCCAGGCGGAAGGAGGATTCTGGGAAGGTGAAGGTG
CTGCTTCACTGGACGCCAGAGGACATACTTCCAGATTCCT
GGGTCAGTGAGAGTGACCGTCCTCAGCTGAAGACCAAAGT
TGTCCACCTTTCACAGCTTCCTCAGGACACAGCGTTTCTG
CTGGACCCAAACATTTACAGGATGTTTTTCTAGAAGACTG
GGTGGGGAGGGCGACTTCTGTCAGTGCCTGCTGACGTACC
CAAACCCAAGTGGACGTGCGGATCTTTTCAGACAGGACTT
CTTCTTTTTTTTTTTCCTCACTTTTTTTTCTTTTTTTAAT
GCTCCGAGTCTGCCAAAGCATGCAGTGAATTTTTAATATG
TGTTTTTATCCCTTGAAGAGGAGAAAAGGCACAAAATCGT
GAACTCTTGTCGGTGCTGGACTGCTGTCTGTCTGCGAGGA
TGTTTCGTGTATCACGGTTGAAGTTTTCACTTTCCTTCCC
AGCGTCCTCTCAAGCTCTTTCAAGTCCTGATTACCTTCTT
CTTGTCCTTCGTTGTCAAGAAAGTGCCCGTGTAAATATTC
CAGGAGATTTGTAATATATTTTTGTACTGCGGAAATTTTA
CTGTACTGTAGATAGCTGACAGAGTTGTACAGAATGTGAT
AGCTGAATAGTTTCTGGAGGATGAGAACGCTTCCATAGAC
GATTTGCGTGTTTTTCCCTTCCTGGTTTTTATTCTAGTAG
GATAATTGATGAAAGTGATGATTTTTTTTTTCTTTCATAA
ACACACGCACAGACTCTTATAACTGCTGCTCCACCTACTG
ATGATGATAATGATGAAGAGGAGGATGATGGGACGTTATC
GTCCTCCAGTCTGCGCCTTTTGTGCGTATTGCTCAAGCCA
AGGAGTGTATAGACACCTCAATGTAATGGTGCTAAAGCTA
ACACTAGCGTAGTGCACATAGGAGAACTATAATGATGGTG
CTTTTTAGATCATGTACGTAATAATAACCCCCTGTTCCCC
GAACATAAAGATCATACTTCTGTCTTTCTAGTAAAAGCTG
AAAATTCTCTGAGAAGTGTTTGTTTTGTTTGTTTGAATGG
TCAGGCTCTGGGCGAGCGCTGGTTTCAGGCCATATAAACC
CAGTGTTTCTCACACAGGACTGTTGTTTATTAGCAGAGAG
CAGGCCTGGGCATCTGGGAGTCGTTTTATTGGGGCAGATT
TGCAAGCGTTGACGTGAAGGCTGTCTGCCAGGACCTTTAG
CTCAGCGTCAGATGCATATAAATGCCCTCTGAATGCAACT
ACCATACACACCTGACTGCATTTGCTTTGGATTTACATTA
TGCCCAATGCGTCTTCATTGATATTGGCTTTGCATACACA
GTCGAGGTCAAAATAATTTGCTTTCCTGTCGATTTTGTTT
TCTTTTTCAGGCATTTCCCAAATGATGTTTAACAGAGGAA
GGAATTTTTTTACAGTATTTAGAGATGTGTTGAAATAAAA
GGAGGGCTTATAA

aebp2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA aebp2-201 2653
aebp2-202 (1) 1501
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aebp2-201 Contained in:
OTHER aebp2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000014838 (1)
  • Ensembl_Trans:ENSDART00000019518 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC055234 (1) 1841bp
    GenBank:EH505295 (1) 886bp
    GenBank:EE316307 (1) 854bp
    GenBank:CK693216 (1) 438bp
    CITATIONS (2)