ZFIN ID: ZDB-TSCRIPT-090929-2928
Transcript Name: aebp2-202
Previous Name: aebp2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000014839 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000014839|OTTDARG00000012575|ZDB-GENE-040426-2885 aebp2|OTTDARP00000012639 aebp2-002 LG_ BX914207.15 Danio rerio protein_coding KNOWN, 1501 bp
GCCTCCAGCAGTTCCACGATCCGTCCGCTCACCGAAAGTC
TCCGCGTTTCACCCGTTTCCCGTCGCGTAAACCCGGCCAG
GCCGCGCACACACCAGCGGAACCCGATGGCTTCGACGACC
TCCGACGCTTCCGAGCAAGAGTCAGCGAACCCGAGCGAGA
AAAACGGCGACGGGAGCGAGTCGGGCCTGCGCGCCGCCGA
TCCGGAACCGGCCGTTAAGATGGACGAAGCGGACACGGAC
GAGAAGCCCGGTGGACACGAGCCTACAGAACAAAGCCCAG
AGGAAGCCACGCGGGACGGGGGTAATGATGAAGACGGGGA
GACCGAAAAGGAGCAGCAGAAGAGCCCCGGTAGCGCGGAC
GGGACGGCGGAGCGGATGAAGAGAGAACAAAGGGAGGAGG
AGAGCGTGTCCTTACCGGCGGAGAAAAACAGCGGCGGCGG
CGGCACCGGAATGAAGCGCCGCGCGAGCCTGGAAATGATG
AGCTCGTCTTCGGACGGAGAGCCTCTCAGCCGCATGGACT
CGGAGGACAGTATTAACAGTACTCTCATGGACACGGAGAG
CATTCCGTCCAGCGGTCGCTCTACCCCAGCTATGATGAAT
GGTCTCGGTGGGGCGTCTTCCTCCACTAAGGGCTCATCTT
ACCCCTGCTGCTGGGATCAGTGCCACATGCTGTTCAACAC
CAGCCCGGACCTGGCCGAACACATCCGCGGAGTGCATGTG
GATGGACAGCGTGGCGGGGTATTCGTGTGTCTTTGGAAGG
GCTGTAAGGTGTATAACACACCATCTACCAGTCAAAGCTG
GCTCCAGAGACACATGCTGTCACACAGCGGAGACAAACCA
TTCAAGTGTGTGGTGGGTGGTTGCAATGCCACCTTCGCCT
CCCAGGGGGGGCTAGCGCGCCATGTGCCAACCCACTTTAG
CTCCCAGAATTCCTCCAAACTTTCAAGCCAAACCAAGGTG
AAGGAAGAATCTCCTTCCAAAGCGGGCATGAACAAAAGGA
GGAAGCTCAAGTACAAGCGGCGGCGGTCTTTGCCGCGACC
GCATGACTTTTTTGATGCTCAGACTATGGATGCAATCCGT
CATCGCGCCATCTGCCTCAATCTAGCAACCCATATTGAGA
GCCAGGGCAAAGGCCACAGCGTTGTGTTTCACAGTACGGT
GATCGCCAGGCGGAAGGAGGATTCTGGGAAGGTGAAGGTG
CTGCTTCACTGGACGCCAGAGGACATACTTCCAGATTCCT
GGGTCAGTGAGAGTGACCGTCCTCAGCTGAAGACCAAAGT
TGTCCACCTTTCACAGCTTCCTCAGGACACAGCGTTTCTG
CTGGACCCAAACATTTACAGATGAATAAATCAGCGTTCAA
GAGTGCCTTCATTTCAAGAATGTCACGTTCAGCCAGACTT
GAGGAGAAACTGAGTACTTGGATCGGTGTTACATAATCAG
GATAGGAAGAGGTATCAATATTCTGTTACAGTTATATAAA
CATTGTGTTCATCTGTAGAAA

aebp2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA aebp2-201 (1) 2653
aebp2-202 1501
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aebp2-202 Contained in:
OTHER aebp2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000014839 (1)
  • Ensembl_Trans:ENSDART00000128934 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN016742 (1) 881bp
    GenBank:AW422593 (1) 736bp
    GenBank:CO351241 (1) 582bp
    GenBank:EX157341 (1) 570bp
    CITATIONS (2)