Transcript

lama3-201

ID
ZDB-TSCRIPT-090929-2812
Name
lama3-201
Previous Names
  • lama3-001
  • si:dkey-121a11.10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000014406 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000014406|OTTDARG00000012307|ZDB-GENE-050208-475 lama3|OTTDARP00000012297 DKEY-121A11.10-001 LG_ CR936359.9 Danio rerio protein_coding KNOWN, 3792 bp
GACTGCGATCGTGGTTATTACAGGGAGAGAAGTGGACCGT
ATAAGGGACGGTGTGTCCCGTGCAACTGCAATGGCCTGTC
CGGTGACTGCGACCCACATACTGGGAAATCGGGTGACCAC
TGTGAACGTTGTATGGAGGGTTATTATGGCAGCGCCATTT
TGAGAACCTGTCGTATGTGTCCGTGCCCCTTAACAGACCC
AGCGAAAAGTTTTGCTGTTGGATGTCTCGGAGTTGGAGAT
GAGTTTGAATGTTTGTGTAAACCTGGCTACTCTGGAGTTC
GATGTGAACGGTGCGCGCTTGGATACTATGGCAGTCCTTT
GGCAGAAAGAGGAAGTTGTCAACCATGTGACTGTGAACAC
GGTTACGTGTGTGACCCGTTAACAGGCGACTGTGATATCT
GTGTGGTTAAGTTAATGGATGATCTTGCAGCGATGGATGA
GGAGTTTGCCAGACTGATTGATCAACTTGGGTCTTTTAGT
CCGAATGCTACTTCATATACGGGACTTGAAAAACTTGAAG
ATGCCATTGCTGATACAAAGGTGTTGGTGCAGAAGTATAC
TGAATCTGTCTTCAAATTGAAACCAAAGATTTCAGAGCTT
GAATCTCATCTCCAAAATGTCAAAGATGACCTAACTGCTC
TCAATGACAAGGCTATTGAGATGTCCTGTTCTGCAGTTCA
GTTGCTCAAGTCTATTGACCAAACCTATCAAAGAGGAGAC
AACCTGCGATCTGAGAGCGTAAACCTCTTACAAAAAATAC
AAGAGTTCTTGGATAAGCTGAATCGGTCAAACAACACAGG
TGGAAACACAGAGGATGCAACCAGGATGTTAAAAGAAGCC
CAGAGGATGCTGGAGAAGATGCGAAGACAGACCTGTAGGG
TTCAGAGAGAGCTGGTCAATGAGGAGTTGAGAAAAGCACA
CATATTGCTCAGCCTCATTTTGAAAGACCTGATTTTTCCT
TTGAATGGTTCTTTGATTGCGGCTGATCGTATTCGTCAGG
ATCTCATGGATCGGGCAGAAGATCTTCGAGATATACAAGA
GGCAATAATAGATGCCCAACTTGATGTGCTCAAGGCCAAT
GGAGTGAACAAACTCAATGAGGAACAGCTGAAAAACATTT
TGAAGCATTTTAAGGCGTTAAGGAAGAATCAAGGAAACAT
CATAGCCAATTTGAACATGGCCAGAGGGACACTAAAAGAC
GCATCTGATATTCAGGAAATGATGGATGAACTAAAAGAGA
ATATGACTCATCTTGCAGCTTTGATCGACGGGGCAAAATA
CAATCTTGAGGCAAAACTCGAGTTGCTCTCTAATGCAACA
GCTAAGCAGGAAGTCGTGAGACAGGCTGAGGAACATGCAC
AAGAACTTACAAAGCTGGCTATAGACTTACAAATGGTCAT
AATGAATATTAAGAACTCAACTGCTGTTCATAAAGCAATT
GAAGCCATCAATGCATTCACAGCCATCACCGCTGCCATAA
ATGAGGCAGAAGCTGCTGCCAAACTTGCCAAAGAAGCGGC
GGACCATGCTTTAAAGGATGTGCAAAAGCAGGATCTTCAA
AATAAAGCCAAGGATCTTATAAATAATGCAAATGCTCTGT
TGGTGAATGCCAAGGAAGCATCAATACAGCTAGAAGATGT
CGCACAGAAATGCGAAGCATACAAGAACCTGATCCAACAG
GCTGAAGACAAACAGAAGCAACTCAAGCAAGTCATGCTGG
ATGTGTTGGAGAAGATGAACAACATCAAAAGAGGCGATAT
TGACATCCTCATCAACCAAGCCAAAGAAGGTGCTGCAGGT
GTGAATGCCACAGCGGCTGATGCGCTAACCAGAATGCAGA
ACATCAGTGAAGATCTGAACAAAGTCAACATTTCCACTCA
AGATCAAAACCTTTATAACTTACTTGATGGTGTCAACAAG
ACCTTGACAGAACTTGATCAAACTTTCCCTTCGTTGATTG
ACAAACTGAATGATGTGGAGAACCAAACAGAGCACTTGCC
TGGTCCAACCAACCTATCAAGCAGCATAGAGAGAATCAAA
GTCTTAATCGAACAGACCAGAGACGCAGCCAACAGAATCA
GAGGGCCAATCCTGTTCTCTGGTAATGCTCACATTGAACT
TCGACCTCCTAAAGACCTGGAGGACTTTCGCACCTTCACA
GCTCTTAATTTTACACTGCACCAACCAAACACCAGAGGTG
ATGGAAGGCGTAGACGGCAGCTGGATTATACAGATGGCCA
GTTTGTTCTTTACCTTGGAAATAAGCATGAAGTCAAGGAT
TTCATTGGCCTGGTTGTAAGGAATGGTGTTCTTTTTTGCC
TCTACAAACTGGGTGGCCAACTTCATGAAATAGAGACGAG
TGAAATCACCAAGTCCAGCAATGATAAAGCCTTTATGGAT
AGGGTGGATTTCCGCAGAGTTTATCAAGATGCACAAGTCA
TATACACACATACTTTCACTTCAACTGAACCCAACGAGCT
GCCAGCAAGGATAAATCAGCCTAAAACCATGAATGGATTG
CTCGATCTGGACCCCAATGATGTCGTTCTTTATGTTGGAG
GATACCCAAGGGATTTTACGCCTCCAGTGGAGCTTCAGTA
CCAGGGATTCAAGGGCTGTATTGAGTTTTCTTCAATAAAT
GATCAAATCCTCGGCTTATACAACTTTCAACGTGCTGTCA
ACATAACCAAAAATGACCTGTGTCAAAGAGGGAAAGTCCG
CACATTGGGGGATTATTTCGATGGCACGGGTTTTGGAAAA
GTGGATATATTAAGCCAGAATTCTTTCATTAAGTTTTTTG
TTCTGAGTCATCAAATGGATGCTGTGCTTTTTTACATGGG
AAATGAGAACTCGTACTTCTTCATTACACTGGAAGGAGGC
TATATTGTTTTGCGAGGTGTAAACAATGACGCGATCATTT
TTGAAAGGTCCAACGTTAAAGTATTTCCTCAAGGCTCCCG
AGAGGCTACTTTTGAGTTTGGCAGTTCTTTGTCGATGTCC
CCCATTGTTAAGGATACAGACTTGGGGACAATGGTTTCAC
TTGGATTTAAGACCTCTGAGGAGAATGTTGCAGTTTTAAT
ACAGACTGGTGGAATGAAGAATGAATTTCTGCTGTCTTTG
AAAGACGGCTTTGTGGAAATGAGTGACAGCAAGGAAAAGT
TAACATCCTCCACCAAATGTGAAACTGGAAAATGGCATTA
CATAACAGCTTTCAGAAGCAGTGCGGGGATGCAGCTAAAC
GTTGACAACACAGATGTTGGAGATCCACCATCTCCATCCA
CATTCCCTGAATTCGCAGAAAGTGTTATTTTAGAAAAGTA
CTTTATCTCTGGTTCTACGTATGATTTAACTTTTGAACTT
CGGCCAAGAAACCTCACCGGCCTCATCTTCCACAAAAGAG
ACAACCTTGGACAGACTGTCACACTATTTCTCAAGAAAGG
AAAGGTGGTGGTAAAAGTGAACGATGGAAAACAACGCTAT
AGCACTGCGGTGACTCCAACACGACCCCTCTGTGGTGCAT
TTCACAATGTGTCAGTGTCCATTCGGCAAAAAAGTATCGA
GCTGAGAGTGGATGATGCAAAATCACGAATCAGACGACGG
TCTATAGCTCGTCTTTCAGTTCATGAAGAAATCTATATTG
GTGGGCTTTCAGAGAATCGGAGTGAAGGAGTCGAGATGCA
GACCTCTTATGAGGGATGTTTGCGGAACATAAGGATTCAT
CAAAATCCTCTCTCATTTGATAATGCGAGTATATTCGGCC
CCATAAACACAAACGAGTGTCCGGCAGAGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations