Transcript

rc3h1a-201

ID
ZDB-TSCRIPT-090929-2706
Name
rc3h1a-201
Previous Names
  • rc3h1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000014055 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000014055|OTTDARG00000012038|ZDB-GENE-050208-702 rc3h1a|OTTDARP00000012013 rc3h1-001 LG_ BX908392.13 Danio rerio protein_coding KNOWN, 3648 bp
TTTCGTTACAGCAGCAGGCGATGCTCGCCCTTCTTCTGTG
AAGATTGAGCTGAACCAAATAATGTTATGTTTTTCACACT
ATGTGCTGAACGCCCACAATGCCAGGAAATATTTAAGAAC
CGTTATCTTTGGAAGAGCTTTATCGGTTCCAGTGGAACCT
TTAGGACTTACCGCCGTATCGTTTTACGCAAAACGCACAT
AGACACCAATGCAGCAATAAGAGAAGACCTTGGGGACCGG
AGCATCACAGACCGCGCTTCGCTACAATGCCCGTTCAAGC
TCCGCAATGGACAGAGTTTCTGTTGTGTCCCATCTGCACG
CAAACCTTCGAGGAAAACCACCGCAAACCCATCAGCCTGG
GCTGCGGACACACTGTCTGCAAAATGTGCCTGAACAAACT
CCACCGCAAAGCCTGTCCGTTCGACCAGACCACCATCAGC
ACAGACATCGAGCAACTGCCCGTCAACACTGCGCTGCTGC
AGCTCGTCAGTGGACAGGTACCCAAAGCTCCTCCCGTGAC
GTTACTGACAGCTGCAGAGGACGTCAAACACTATGAGGAG
TCACGCACGTGTGTGGAGGATCTGGCGCTCTATCTCAAAC
CCCTCAGCAACACCAGAGGTGCAGGTCTGAATGGCGCAGC
TCAGAGTGTCCTCAGCAGGCCCATGCAGAGGAAGCTGGTG
ACGCTGGTGCACTGCCAGCTGGTGGAAGAGGAGGGCCGCA
TCCGGGCCATGAGGGCAGCCCGTTCCCTGGGCGAACGCAC
AGTCACAGAGCTCATTCTCCAGCATCAGAACCCCCAGCAG
CTCTCCTCCAACCTATGGGCCGCCGTCAGAGCCAGAGGCT
GCCAGTTTCTTGGCCCTGCCATGCAGGAAGAAGCATTAAA
GCTGGTTCTGCTCGCTCTGGAGGATGGTTCGGCCCTTTCA
AGGAAAGTTCTGGTCCTGTTTGTGGTCCAGAGATTGGAAC
CACGCTTTCCTCAGGCCTCCAAAACCAGCATAGGACACGT
GGTGCAGCTCCTCTACAGGGCCTCCTGCTTTAAGGTGACC
AAGCGTGATGAGGACTCCTCCTTGATGCAGCTGAAGGAAG
AGTTTCGCACATATGAGGCTCTTCGTAGAGAACACGACTC
TCAGATCGTCCAGATCGCAATGGAGGGCGGCCTGCGCATT
GCCCCAGACCAGTGGTCTTCTCTCCTGTATGGCGACCAGT
CCCACAAGTCCCACATGCAGTCTATTATTGACAAGCTTCA
GACTCCAGCATCTTTCGCTCAGAGCGTGCAGGAGCTTACC
ATCGCCCTGCAGAGAACCGGAGATCCTGCCAATCTGAACC
GCCTCAGGCCTCATTTGGAGCTGTTGGCCGACATCGACCC
CAGTCCAGATGCCCCTGCGCCCACATGGGAGCAGTTGGCT
AAAGGGTTGGAGGCGGTACGGACTGTTGTTCATGGACTGG
TGGATTTCATCCAGAACCACAGCAAGAAGGGAGGGGATCA
GCAGCAGCCTCCTCAGCACAGCAAATACAAGACCTACATG
TGCCGTGACATGAAGCAGAAGGGTGGCTGTCCCCGTGGAG
CGAGCTGCACCTTTGCTCACTCTCAGGACGAGCTAGAAAA
ATACCGTAAGATGAACAAGCGTGTGGGGATGCGCCGTCAG
CTCAGTCAGTCTCTTACCCAGCTGAATGAGCTGGATCTGG
GACTGTTATCTGACGACGGGCCGCCCATGGAGGGTCTGCC
ACGCAAATCCTCCTCTATCACCAACGGGATACTGGCAGCG
GGACCTGGATCGGCTCTGGCTCATCTGGTTTCCCGAGGCT
CGGACCCATCTTATGAGCCCACACACAAACCTACCAAGAT
GGATTCTGGGAGCCTTAGTGCACCTGGCTCACCTCCAGAC
TCATTGGAATCCATACCGAAACCATCAATGCTCATGAATG
CCCAGTCCAGGATAGCAGGCGATGGCGCAGTGGGACAGAA
GCACTTGTCTGCGGTGCCTAGAGTTCCTCAGATGTATTCG
TCACACCAGCCTGACCTGTATTTCCCTGAAACAAGAGCAC
CACCACCACCATCTGCCTCATACGAATCCTCCCAGTATGC
CACAGCTGGTAATCCTTACCCCCACCATCATCGTTACCCC
CGTCATCCCGCACCCGATCCAGGAATGTCGCCATATCCGG
ACTCTTATCCCAACTCCTACGTCTCAAAGCACCAATACGC
CAATCCTAGCGCTCATTATGGATACCCTTCACGCCATGAC
AACCGATGCCACTCACCCTACGCTCATCCCCAAACATTCG
CCCCACGTGAAGAGCTAGTCCGAAGAAGTCCAGACATCCC
TCCCCCGCTACAACCCCAAAACACCAGCACCTCATATCTA
CCCGAATCTGCTCAGGAGAGATACACCAATGACACCTATA
ACCATCCCAGCCAGATCAGGAATTATCACAGGAATGCCTA
CCCTCGAACTCAGCACTCGCTGGACTACCTGCACCGGCGC
AGAAAGGAGATCATGGCCCAGCTGGAGGAGAGGAAGGTTG
TTTCTCCACCGCCTTTCGCCTCTTCACACTCTTATGACTC
GGGCTACCCTCAAGATATGAGGGCACAGAGAGATTACATT
GAGAACTCGCATGGATTTGGACACTTCCGGGAACCGGACT
ACACTGCCTCATATTCACCATGGTTATGTGACACCATCGG
TTCTTACATCGGCAGCAAAGACATGAAGTCCAAAGAGGGC
ATGCACTCCATGGACGCACAAAATGTAGAGAAAGGCAAAA
GTCTGCGAGTACACGGCTTGGAGCTTCAACGCAGAGCGAC
TGAAGTTAAAGACGATGACCCCATCATTCCCTTTGGCTCC
CTGCCAACCGTGTCTCGTTTCGGAGCCATTTCGCGCACAT
CTAAACCGGGCTTCCCGCCAAACAGTCCAATGCCACCCTT
GCCAAACTCTGCCAAGCACACCGCTGATTATACCTATGCG
AACCACAGTGGGTGGAGTGGTGACTCCTACCAGTCACACC
AAACGTCTCAGGGCCACTTCAGCGAGCGGTCCAGTTTATC
TCCTGCCGTACAGGCCCGCGAGCAGCTCAGGATGGAGCTA
CAGCAGGTCAACCAGCAAATCAGCCAACAGACACACCCCC
GCCTGGAGAACTCCAGCTCAGTGATGTCCCAAGCATCTCG
GGTGGACTGGAGCTCTGGGAATTTGTCCAGCGAACAGCTG
AGTTTCGAGCTGCACCAGGTGGAGAAAGAGATCAACAAGA
GGTCACAGGAGATGGAGAACCATGATGGCAAATACAAGCG
CATCTCAGTTGAAAATGGACCAGATGAACATCTTCTGCAG
AGAGATGAGCATCAACTGAGTCTGAGTGAGGGCTCCAATG
GTTCCATGGGTTTGGTCCAGGACTGTGGTCTCGTCAGCAG
CAGCATGTCCTCACTGACCAGCAAGACGTCCTCGCTCAGC
TTGTCCTCTGAACAGGTGGCCAGCAGCCCCGATCTGCCCA
AGAATGGAGTCGTTCACTCTTAGCCGGCTCATATTCTACC
TCATATTCCCCTTTCGCAACATCTTTCCCAGGTTAAACCC
TCCGGGCGCTCCACCATTGCTGTATAACACACCGTTCATT
CACTTAAAGTTAGCTTCATCCGCTGACCCTCAAACACCCT
TCAGGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations