Transcript

ndufb11-201

ID
ZDB-TSCRIPT-090929-2606
Name
ndufb11-201
Previous Names
  • ndufb11-001
  • si:dkey-6n6.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000013680 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013680|OTTDARG00000011722|ZDB-GENE-050309-25 ndufb11|OTTDARP00000011686 DKEY-6N6.4-001 LG_ BX004884.10 Danio rerio protein_coding KNOWN, 816 bp
CGTCTTCATTTTTAACCCGGAAAAAAATAACTCGAAGCGG
TAGCTGTCTCGAAACCACTTCGAGTACAGAAAAGTCGGGA
GAATGCTCTCACGTCTGAGCCGAATCTACCCTGCTTTGTC
CCGGGTTCGTCTGAGCTCGGCGCTCGGGAGCCGCTTTGTA
TCTCAGACGCCGCAGTCTAGCGCGTCCGGAGCTTCGGTGC
CTGCTGATCTGCGGCCCTTTGCTCCGCCGCTTCAGGACAG
TCATGGACACGCAGAGGTCAGCCCGTTTGACAAGAATCCA
GATTTTCACGGCTTCCATCATGACGAACCAATTGTGGATG
AATGGAACATGAAATTGGCATTTTTCTTTTCCATTTCTTT
GGTCATTGTTGTTGGAAGCACTTTCATTCACTATTTACCA
GATCACGGCATGAGGCAGTGGGCTCGTCGGGAAGCTGAAA
GGTTGATCGTACAGAGGGAAGCTGCTGGTCTTCCCGTCCT
GACTGAAAATTACTACGACCCAAGCACCATTGTTCTCCCC
TCTTCAGAAGAGTAGACAGCATATTGTCATTAATTATCCT
GTTAATTTGTGTTGGACTGTACATTTGCCTCTCCTCAACT
CTATTATAATAAAATGTTATAATATAGCTGAATGTGGTAT
TTTCAGTTGCTGTTATTTTCATACTCATCATTGATAAAAT
AAATGCACTCTCAGTGAGCAGAATAAACTCAATTAATTTA
AAGAGAATGTTAAAAACTGTAAAGCTTACAAACTTTTTAG
CCATTCGGTGTGTGCATATGTCTTATGCAGAAGGCACATT
AAAGAAATCAGAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations