Transcript

rbbp9-205

ID
ZDB-TSCRIPT-090929-2524
Name
rbbp9-205
Previous Names
  • rbbp9-002
  • si:ch211-258l4.7-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000013453 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013453|OTTDARG00000011534|ZDB-GENE-050208-692 rbbp9|OTTDARP00000012430 CH211-258L4.7-002 LG_ AL953867.18 Danio rerio protein_coding KNOWN, 1198 bp
AATGTATAAAGCAGACCCAGATGCTGTCTGTTCAATGTAA
ACGCCTCGCTTAAAATAACTTCAGCTCGTAGTTTGCAGTT
GACAAAAAGTCGGAGAAGTTAAAACTCAGAGCAAGATGGC
GGACTGACCTCCAGGAGGCGCTGCGCTGCGGAATATCGCT
CCACATGCCGTCTGGGGTGTTTCCGTGTATGAGTTTTTGA
GTAAGGAGCTGGATTTTGCTGTTATAATGCCTCTGAAGAG
AGTTGTGATTGTGCCTGGGAACGGCGCAGGAGATGTTGAG
CGTAGCAACTGGTACGGATGGGCCAACAAACGAATAAATG
AGATTCCAGATCTGTCTTGTGCACTGAAGAACATGCCGGA
TCCTGGATATTTCAGCCGACCATGGGAATGGGAAAAGATA
CGAGCAAATGTGGAGTACATCCTTCAGTTCGGCTCTACAG
ACGACCCGTTTTTGCCCTGGGACGAGCAACAGGAAGTTGC
TGATGGACTGAAGACAGATTTACATAAGTACTCGGACCGC
GGACATTTCCAGAACACAGCCTTCCCAGAGCTCATCGATG
CAGTAAACAAGCTGAAAACCAACAGCTAAACATCAACCCT
GTTTAAAAGGTCTGTTTTGGGCGCCAGATGAATCTTTTGA
TACAAGAAGTGAAGGAAACTTACAATTGTGTAATACAAAT
CTTAAATTTTCAGCACAAGTAGATCTTCAAATACAGTAGT
GTGTAGAAATCAAAACATCTGCACTCAAATGGCCATGATG
GGACAAAATACACAACGTCAGATTACTGCAACAGCTTAAA
TCAATGAGCACATCTGAGCGAGCATCATCCCCAGTTCACA
CACGAGTGGTCAAACTTTACAATGAGCTTTCATTAGTTTA
ATGTGTTCACTAACATGACTTATGAACAGTGTTTGTAGAA
GCATAGCTCAACGTCTAAATGCATGCTGGGTAGCGTTAGT
TAATGCACCATGAGTTCACAAACTGTATGAACATGAACAA
ATGCTGTAATAAACTGTGTGTTGTGCATTGTTTACTGTTT
TAGTAAATGCATTAACTAATACAACCTTACTGTAAAGTCT
AATAACATGCCTTACACATGAAAGTTAGCAGGTGAATTGT
GGTTATAGCACCATTTGTTGAAGGTCAATAAAAAGGTTTC
ATTGATGTATACACACTCTCTGATTGATCATTTAATAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations