Transcript

rbbp9-203

ID
ZDB-TSCRIPT-090929-2523
Name
rbbp9-203
Previous Names
  • rbbp9-001
  • si:ch211-258l4.7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000013452 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013452|OTTDARG00000011534|ZDB-GENE-050208-692 rbbp9|OTTDARP00000011479 CH211-258L4.7-001 LG_ AL953867.18 Danio rerio protein_coding KNOWN, 1390 bp
AATGTATAAAGCAGACCCAGATGCTGTCTGTTCAATGTAA
ACGCCTCGCTTAAAATAACTTCAGCTCGTAGTTTGCAGTT
GACAAAAAGTCGGAGAAGTTAAAACTCAGAGCAAGATGGC
GGACTGACCTCCAGGAGGCGCTGCGCTGCGGAATATCGCT
CCACATGCCGTCTGGGGTGTTTCCGTGTATGAGTTTTTGA
GTAAGGAGCTGGATTTTGCTGTTATAATGCCTCTGAAGAG
AGTTGTGATTGTGCCTGGGAACGGCGCAGGAGATGTTGAG
CGTAGCAACTGGTACGGATGGGCCAACAAACGAATAAATG
AGATTCCAGATCTGTCTTGTGCACTGAAGAACATGCCGGA
TCCTGTAACGGCCAGAGAGAGCGTCTGGCTGCCGTTCATG
GAGAAGGATCTGAAATGTGATGAAGAAACGCTCATCATCG
GACACAGTTCAGGAGCGGCCGCAGCCATGAGGTATGCAGA
AACACACAAGGTTTTTGCCATTATTCTGGTGGGCGCCTAC
ACATCACATCTGGGAGATGAGAATGAGCGTGAGAGCGGAT
ATTTCAGCCGACCATGGGAATGGGAAAAGATACGAGCAAA
TGTGGAGTACATCCTTCAGTTCGGCTCTACAGACGACCCG
TTTTTGCCCTGGGACGAGCAACAGGAAGTTGCTGATGGAC
TGAAGACAGATTTACATAAGTACTCGGACCGCGGACATTT
CCAGAACACAGCCTTCCCAGAGCTCATCGATGCAGTAAAC
AAGCTGAAAACCAACAGCTAAACATCAACCCTGTTTAAAA
GGTCTGTTTTGGGCGCCAGATGAATCTTTTGATACAAGAA
GTGAAGGAAACTTACAATTGTGTAATACAAATCTTAAATT
TTCAGCACAAGTAGATCTTCAAATACAGTAGTGTGTAGAA
ATCAAAACATCTGCACTCAAATGGCCATGATGGGACAAAA
TACACAACGTCAGATTACTGCAACAGCTTAAATCAATGAG
CACATCTGAGCGAGCATCATCCCCAGTTCACACACGAGTG
GTCAAACTTTACAATGAGCTTTCATTAGTTTAATGTGTTC
ACTAACATGACTTATGAACAGTGTTTGTAGAAGCATAGCT
CAACGTCTAAATGCATGCTGGGTAGCGTTAGTTAATGCAC
CATGAGTTCACAAACTGTATGAACATGAACAAATGCTGTA
ATAAACTGTGTGTTGTGCATTGTTTACTGTTTTAGTAAAT
GCATTAACTAATACAACCTTACTGTAAAGTCTAATAACAT
GCCTTACACATGAAAGTTAGCAGGTGAATTGTGGTTATAG
CACCATTTGTTGAAGGTCAATAAAAAGGTTTCATTGATGT
ATACACACTCTCTGATTGATCATTTAATAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations