Transcript

alpi.2-201

ID
ZDB-TSCRIPT-090929-2515
Name
alpi.2-201
Previous Names
  • alpi.2-001
  • zgc:110409-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000013425 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013425|OTTDARG00000011517|ZDB-GENE-050626-142 alpi.2|OTTDARP00000011460 CH211-262H13.2-001 LG_ BX927181.16 Danio rerio protein_coding NOVEL, 2566 bp
GAGTACTATTGACAGTAGTTCACCAGCTTTCCATGATGAT
TAGCTTGTAGATTACCAAGCCACAGTTTGGGAAGAGCTTC
CCCACTGATAATCGTATCATAAGGTCATATATGATTAGTA
CATGATAAACCGCTCATGTAGCAGAAGTGCGAGTGCTAAC
CTTTGGTCGGACTGAAGAATATAAACATCAGTGTGAGCTT
CAGGCATGCAGATCTCCAGAAGCTCAATCATGGCCAAAAC
ACAAGCCCTGCTGCTCATTGGAATATTCGCATCAGCAGGA
TTCGATGGATGTTTCTCCGTTGTTCCTGAGGAGGAGAAGA
ACCCAAACTTTTGGTATGTAAAGGCTAAAGATTCTCTACA
CGCATCGCTCTCAATGACATTCAACACGCACCGCGCCAAA
AACCTCATCCTCTTCCTCGGAGATGGCATGGGAATCAGCA
CCGTGACCGCAGCAAGAGTCTTGAAGGGACAGATGAACAA
GAAAACAGGAGAAGAAAGTGTCTTAGCCATGGACACCTTC
CCGTACCTCGCTTTGTCCAAGACCTATAATGTGGACCAGC
AGATGCCTGACAGTGCAGCGACGGCCACTGCGTATCTCTG
TGGTGTGAAGGCAAACTACGGCACTCTGGGACTCAGTGCG
GCTGCGCAGAGAGAAGTCTGCAGCTCCGTTAAAGGCAACG
AGGTCAAATCCATCCTTCATCAGGCCAAGATGGCAGGGAA
GTCTGTCGGTATAGTGAGCACAGCACGTGTCCAGCACGCG
TCGCCCGCCGCCAGTTACTCGCACACCCCTGAGCGAGGCT
GGTACAGCGATAAAGAGCTGACGTCTGAAGCCGTGGCAGG
AGGATGCCAAGATATCGCAGTCCAGCTCATCACTAACACG
GATATAAACGTTATTTTAGGTGGCGGCAGGCAGTATATGT
TTCCTCGGGAAACCACTGATCCTGAATACTCCACAGTCAC
AGGGAGCCGGAAAGACAAGAGAAATCTTGTTGATGAGTGG
CTAAAAAACAGAAAAAATGCTCAATATGTGTGGAATAAAC
AACAGTTTGATGCTGTAAATGAGGACAAGACAGATTATTT
AATGGGGCTTTTTGAGCCAAAGGACACCAGGTACGAGCTG
GAGCGTGATCCTAAGATGGACCCGTCGCTGACAGAAATGG
TGGAAAAAGCCATAAAGATTCTCAGGAAAAACCCCAATGG
GTTCTACCTCTTTGTGGAAGATAACGGGAGAATAGATCAC
GGCCATCACGCGGGACAGGCCAAATACGCTCTGACTGAAG
CTGTGGAGTTCGACAATTCTATCGAGCGGGCCGGACAGCT
GACCAGCGAACTCGACACCCTGTCTGTGGTCACCGCTGAC
CACTCACACGTGTTTTCTTTTGGTGGATACTCCTACAGGG
GAAACCCTGTGCTGGGTGTTTCCTATGCCAAAGGTGAGGA
TGGAAAGAGTTTTACCAATGCGCTTTACGGAAACGGTCCA
GGATACCAGATCACTAACGGGACTCGACCTGATGTCAATG
AGAGCGTTTCAGGCCGTGATGACTATCTCCAACAGGCTGC
GGTTCCTCTTGATTCAGAAACTCATGGCTCGGAGGATGTG
GCTATTTTCGCTAAAGGCCCGATGGCGCACCTCTTCCACG
GGGTGCAAGAGCAGAGCTACATTCCTCACGCTATGGCCTT
CGCAGCCTGCATCGAGCCGTACAGCGACTGTCAGCTACAC
GACTCTGGTGTCTACACTCAGTTCAGCGCCGCGGTGCTGC
TGTTCAGCCTGATGTCCTCCATTACTGCTCTTATTTAACC
TGACTGCACGCTTCTACATCCCAGTAGAGCTTATTACAGT
TGAACATATGAAACCTCCTGTTGTCTTAAGTCCACTGAAG
TTTTTTTTTCTTATTAAAGCAGACCTATTATGCCCCTTTT
TACAAGATGTAAATGAAGTCTCTGATGTCCGGAAAGTGTG
TAGTGAATTTTCAGCTCAAATTACCACACATATAATGTTC
TGAAGCTGCCCATGTTAGATTTAGATCCACATTGTGCCAT
TTTAATGACTGTCGCTTTAAATTCAAATAAGATTTTCAAA
AGGGGCGGAGTCACAAATGTTTGTGTGTCACCATAGTGAC
AGATTCAAAACAAGATTAACCTTATCTGTGTGAAACCGTG
AGGAGCCTCAGAAGAAGGCAGAAGTCTCCTGTATCCTCTT
AGTCTATGCTGACTATTATCTTTAGCAGCTCAAACACTCT
AAAGGTTGCTTCTCACTCAGGGCTGCTGTTTATGTTAATG
AGGATGAGATCATCATGAATGGCTTTCCCTGTCTGATGAC
ATGTACAATGTCTTTTTACATTTTTACCATTAGCAGCTGG
TTATATTCAACTGGTTATGTTTAAACCCCTTATTATAAAG
TGATTTTTGTAAAATAGGTCCCAGTTAAGATATTGAAATC
CTCTGTGAGGACGTGCATTTCTTAATTCATTAGTTAATTA
ATTAATTACTGAGTTTGCAGCATTTCTTTCTTTAGGCGTT
GGACAAATGAGGCTTGATATTTGTCAATAAAATCTGACAT
TTAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations