Transcript

apoa1a-201

ID
ZDB-TSCRIPT-090929-2479
Name
apoa1a-201
Previous Names
  • apoa1-001
  • apoa1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000013337 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013337|OTTDARG00000011440|ZDB-GENE-990415-14 apoa1a|OTTDARP00000011386 apoa-001 LG_ BX465852.6 Danio rerio protein_coding KNOWN, 974 bp
CTCGAACATTCAGAGCAGCACCTCTCAGGGCTTAATCATG
AAATTCGTGGCTCTTGCACTGACTCTTCTCTTGGCCTTGG
GTTCCCAGGCCAATTTGTTCCAGGCTGATGCCCCGACCCA
GCTGGAGCACTACAAGGCAGCAGCCTTGGTGTACCTGAAC
CAGGTCAAGGATCAGGCTGAGAAAGCCCTTGACAACCTGG
ACGGAACCGACTATGAGCAGTACAAACTCCAGCTTTCTGA
GAGCCTGACCAAGCTCCAGGAATATGCCCAGACCACCTCC
CAGGCTTTGACCCCCTACGCCGAGACCATCTCCACCCAGT
TGATGGAGAACACCAAGCAGCTGCGCGAGAGGGTCATGAC
TGACGTTGAGGATCTCCGATCCAAGCTGGAGCCCCACCGT
GCCGAGCTGTACACCGCGCTGCAGAAGCACATCGATGAGT
ACCGTGAGAAGCTGGAGCCCGTCTTCCAGGAGTACTCCGC
TCTGAACCGCCAAAATGCTGAGCAGCTGCGTGCCAAGCTG
GAGCCCCTGATGGACGACATTAGGAAGGCCTTCGAGTCCA
ACATTGAGGAAACCAAGTCCAAAGTTGTGCCAATGGTCGA
GGCTGTTCGCACTAAGCTGACCGAGCGTCTTGAGGACCTG
AGGACCATGGCTGCCCCCTATGCCGAGGAGTACAAGGAGC
AGCTGGTAAAGGCTGTCGAGGAGGCCAGGGAGAAGATCGC
TCCACACACCCAGGACCTCCAGACTCGCATGGAGCCCTAC
ATGGAGAACGTGAGGACCACATTCGCACAGATGTATGAGA
CCATCGCCAAGGCCATCCAGGCATAAAAGTGCACACGCTA
ATCCTCTAGCAACATCAAAGAACAGATAATCTTGCATTTG
GTGATAGAAGGAGAGAAGATCCAAAGGCTGTGTGATGAAT
GTTTATTATGTTCAAGTTAAATAATGCACAAAATAAAAAT
CACAAAAAAAAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations