Transcript

ctsll-201

ID
ZDB-TSCRIPT-090929-2472
Name
ctsll-201
Previous Names
  • ctsll-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000013321 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000013321|OTTDARG00000011428|ZDB-GENE-041010-76 ctsll|OTTDARP00000011374 CH211-137I24.1-001 LG_ BX119902.4 Danio rerio protein_coding NOVEL, 1424 bp
AGTCAAACATTTCTTTCGCTTGTGAAAGTCTTGCAGGCAG
AATGCTGTTGTTTGCCTCACTCGTCACACTGTGCATAAGC
GCAGTGTTTGCTGCTCCAACCCTAGACCAGAAGTTAGATG
ACCACTGGCACCTCTGGAAGCGCTGGCATGAAAAAAGCTA
TCATGAGAAAGAGGAGGGCTGGAGGAGAATGGTTTGGGAA
AAGAACTTGAAAAAAATTGAGCTACACAACCTTGAGCACT
CAGTGGGCAAACACACCTTCAGACTGGGAATGAATCAATT
TGGTGACATGACAAATGAGGAGTTCAGACAGGCAATGAAT
GGTTATAACCGTGACCCCAACCGGAAGTCAAAGGGCTCAT
TGTTCATAGAACCCAGCTTTTTTACAGCCCCTCAACAGAT
TGACTGGAGACAGAAGGGCTATGTTACTCCTATCAAAGAC
CAGAAACGGTGTGGATCTTGCTGGGCTTTCAGTTCAACAG
GTGCCTTGGAGGGTCAAGTCTTCCGGAAAACCGGAAAGCT
GGTTTCTCTGAGTGAGCAAAACTTGATGGACTGTTCCAGA
CCACAGGGCAATAATGGTTGTGATGGAGGCCTCATGGACC
AGGCCTTCCAATATGTTCAAGACAACAACGGGCTGGACTC
TGAAGAGTCATACCCTTATCTTGCAACGGATGATCAGCCA
TGCCATTATGACCCCCGTTATAGTGCTGCAAATGTCACCG
GTTTTGTTGACATCCCCAGTGGTAAAGAGCATGCTCTTAT
GAAGGCTGTTGCTGCTGTGGGTCCTGTAGCTGTTGCTATT
GATGCAGGACATGAATCCTTCCAGTTCTATCAGTCTGGCA
TCTATTACGAGAAGGCATGCAGCACCGAAGAACTTGATCA
TGGAGTCTTGGTGGTTGGTTATGGTTATGAGGGGGTTGAT
GTTGCTGGAAGGAGGTACTGGATCGTGAAGAACAGCTGGA
CTGACAGATGGGGTGACAAAGGCTACATTTACATGGCTAA
AGACCTAAAGAATCACTGTGGCATTGCGACATCAGCCAGT
TACCCCCTAATGTAAAGCAATTAGAGCTTTCTCTGCATTC
TGGAAATGACTTTTGTTTGATTTTAATGTGAATTTGTGTT
CAATTTTATCAATGTTTTGCTGTTAGGCCCAAGATGTTTT
AGACAAGTCTTACAGTTTTAGTCTAGAACACTGACAATAT
TTGTATCAAGTGATTACTAAAGATTTAGTAACCTGTTTTT
GGTTGACCCAGTGAACCATTCTGCATTGTGATGCAAGTCA
TTTCACTACATCTAAAGCTTAAATGTGAGTATGGTAACAA
GCTGCTTTAATGTAAGAGGCGATCCATGAATGTACAAATG
CTGTGCCTTTATCTTCTGTACTTAACCTGTGAATGGATGA
ATAATAAATATTCTGTCATGGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations