ZFIN ID: ZDB-TSCRIPT-090929-2362
Transcript Name: brd1a-202
Previous Names: brd1-001, brd1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000012922 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000012922|OTTDARG00000011126|ZDB-GENE-041008-168 brd1a|OTTDARP00000011092 DKEY-164M14.6-001 LG_ CR751234.13 Danio rerio protein_coding KNOWN, 4208 bp
GTTGGTTGCAGGCGAGAATCACATCAGACAGAAAACGACA
CTGGTGTTGAATAGCAATCAAACTGTGCGTTTTTCTGGTG
TTTATCAGTAAAGTGTTACAGTCCTGGCGATCGCTGCTGA
TAAGCGTTTGCAGCATTACAGATTTATTCATGCAAAACTA
AATTATTGGCCCTCGGATGAGAACATTGTGTGCGGAATTA
CGGCAGGCCATCTAGCAATCGCTGTAGAAAGCTGCTTCTT
TCTTTACACAACAGATCAGAGCTCTGTAAGGACCTCCAAT
GAAAAGAAAGTCACAGCCTCTCAACATATTCACCCCCCAC
CGTGAACCACTGACTTACGCCCAGGCCCAAAGGATGGTGG
ATCTAGAAGTTGATGGTCAGCTCCACCGTATCAGCATCTT
TGACAAGCTTGAGATTATCACGGATGAGGATCCTTTGGCA
CAGGAAATTATAAAGTGCATCAGCAGTAAGGAGAATGCTG
AAAAACACCTGCAGATTTCAGAATATTCTGCACAAATCAA
AAACAACAATCAGAAAAAGAACACATCTGACAGTAGTATT
CAAGGCAGCATCCTTCCTGAGCCCAAATTTCACACTGTGG
ATTACAATCTTCCAGTAATTCCAAGCAGACCTTCTACATA
CTACAAATATAAGCAGAAAACTGTAGAAGAGCTGGACCAG
GAGGTGGAATATGATATGGATGAAGAGGACTTTGCCTGGC
TTGACCTGGTCAATGAGAAAAGGAAGGATGAAGGTCTCAA
TCTGGTTTCTTTCGATGACTTTGAGTTTCTTCTTGACCGT
TTTGAAAAAGAGTCATTCTTAGAGAGTCAAGGCCAACATA
CCCTACAGTCAATAGATGATGAAGATGCTGTTTGCTGCAT
ATGCATGGATGGAGACTGCATGGACAGCAATGTCATCCTC
TTCTGTGACATGTGCAACCTAGCTGTTCATCAGGATTGTT
ACGGTGTTCCATATATTCCAGAGGGTCAGTGGCTTTGCAG
ACATTGTCTACATTCCCCAACACAACCTGCAAATTGCATC
CTCTGCCCTAACAAGGGAGGAGCAGTAAAACAAACTGAAG
ACGACAGATGGGGTCATGTGGTATGTGCTTTATGGGTACC
CGAGGTTGGGTTCTCCAACACGGTTTTTATAGAGCCTATT
GATGGTGTCTCAAACATTCCCCCTGCTCGATGGAAACTTA
CTTGCTACCTCTGTAAAGAAAAAGGTGTTGGAGCTTGTAT
CCAATGCCACAAAGCTAACTGCTACACTGCATTCCATGTC
AGCTGTGCACAGAAGTCTGGTCTTTTTATGAAGATGGAGC
CTATTAAGGTTTTGACTGACTCGGGTATACCCACATTCTC
AGTGAAGAAGACAGCCTATTGTGGGGCCCACACTCCAAAC
GGCTCAGTTAAAAGACCTCTTGCAATATATAAAGACAATG
AGACAAATTATGGGCTTTGCCAGTTGGTAGATAGAAAGAG
CAGCAGAATAGGATTTAACAAGCAGAAGAGACTTAAAAAA
AATGAAGAGGCTATTGTAACCACAATTCCTCCCTTGTCTG
TACCCAGCTTTTCATCGGAAAGATTGTCCCCCATTCTCAA
CCAAGTTTCTTTGCAAAAGAAGACAGCATTTGGTGAACTT
GTCTTGAGTTACTGGACCCTTAAACGACAATCTAGAAATG
GAGTGCCACTGAACAGACGCCTCCAAACTAGACTACATCC
CCCCAAAAACAGTCAGCGCAAACAGACAGAGGAGGAGACT
CAAGCACTGAAAGAACAGTTGAAGGAGTGGCATCAGTTAA
GGCATGATCTTGAGCGTGCACGAATACTGCTGGAGCTGAT
CAGGAAAAGAGAGAAACTCAAGAGAGAGGAGGTATTGCTT
CAGCAGACATTAATGGAGTTCCAACTCACTCCTTTCACAG
TCATTTTGAGGGCTGTCCTGGATCAGTTACAAGAGAAGGA
CCAGGCACACATTTTTGCAGAACCTGTCAACATTAAAGAG
GTTCCTGACTATATGGACCATGTGTTGCATCCAATGGATT
TTTCTACCATGAGCAAACGCATTGAAGCACAAGGCTATAA
GTATCTGGATGAATTTGAAGCCGACTTCAATCTAATTACT
GATAATTGCATGAAGTACAATGGGAAGGATACATTCTTCT
ATAGAGCAGCTGTCAAACTGAGAGACCAGGGTGGAGCTAT
CCTCAGGAAAACTCGTCGAGATGTTCAGAGAATCGGCTTG
GATTTGGAAACTGGCTTGCATCTACTGGAACCACCCAAGA
TTGAGCCTTCTGTTCCTTTTTCTTGGGAAGATGTTGACCG
CTTATTGGTTCCAGCAAACCGAGAACACATGTCTTTTGAA
GAGCAGCTGAGGGAGCTACTGGAAAAGTTGGATATGACTA
CAGCAATGAAATCCAGCCCGTCACGCAGCAGACGACTGAA
ACTGCTCAAGAAAAACATCAGTGACGTGAGGTTGGAGCTG
AGTTTGAGGAAGGCTCTTACTGCTGTTAAACTGAAGAATG
CTGCAGAGGAAGAAGTTGGCCATATCCATCAAAAAGGTGA
CAAATCGGTCCCACCAAAACTTGAGCCATCTGTTTCTGTG
CTGCCTCTCATTAATGCGGAAAGTCACTCTGAGCCACCTA
CACTGAAACCCATTGAACCCAATCCCGACAAACACTCGCA
CCAGAAGGATGGCATTTCCCAGTCACTTAATGGAGACTCT
CATCTGCTTTTAGAGGACAGTGACATCAACGTAGTAGCTA
CATCAACTCTGGCTGAGCCATCAAGTCCAGTTAACCGACG
AACTTCTGTGCTTTTTCGCAAATCAAAAAGCAGCACAAGC
CCTCTTAGGACTTTGAAAGATGATGAAACTTTGAAGGGAA
GTTCGCAGATAGGTACAAAAACATTCTTGTCAGTCGTCAT
ACCTCGCCTGGAGACATTGCTCCACACCAGGAAGAGGCCA
CGGAGTGCCAGTGGAGACAGTTGCAAGGATGAATTGCCCG
TCAAACGGCTGGACACGGAGCTGTCAAACAGTTTTGGCCT
GAATTCAGAAAGAGAGTTGTCTTCTAGCAGCCAGCCTCGT
CAAAGGTGCACATCTGAATCCAGCATGTCCTCCAGCAACA
GCAGTATTGCACTTAATCTTACGAAGTGTGGAAAGGGAAA
GCCAGCCCTAATCCGAAGGAACACTGTGGAGGACAAAAGT
GAGATTATTGCTTGCATCGAGAGTAGAAACTTTGCTAAAG
CTGCTAGAATAGCTGCTGAAGTTAACAGCAGCAGTATATG
GATGCCTTCTAATGCAGCCACAGTTTTGCTGGAACCTCTT
AAAGTAGTTTGGGCTAAATGTAGTGGATACCCTTCATACC
CTGCCCTGATCATAGACCCTCAAATGCCACGGGTGGGGTG
TCAGCACAATGGAGTCTCTATCCCAATGCCCCCATTGAAT
GTGCTACAGATTGGAGAACAGATGCAGTACAAGTCCGAAG
AAAAACTTTACCTCGTTCTCTTCTTTGACAACAAACGCAC
CTGGCAGTGGCTTCATAAATCTAAGATGGTTCCTCTTGGT
GTTGACAAAACCATCGACAAAATTAAAATGATGGAGGGTC
GTACCTCAGCCATTCGCAAGGCTGTTCGGACTGCCTTCAA
CCGTGCAATGAACCATCTTAATCATGTCCAAGATGAACCT
GTTAACGACTTCAGTGATGTTGACTAAGATTGACAAATGT
AGGCACATTCCATAGCTTTAGCAATGCCTATTTCATACTG
CAGGATTTTAAGCTGGATTTGCAAGTTAACAAGCTTGCTG
ACAGATCGGGGTCTGAAAAGTATTACCGATGTTCGGCAGT
TTTACGCCACAGTCACACTAGAGTTTGAGAATACTAAACA
CTGATTAAACAAACTCCATATTTAAAATTTACACATTTCA
CATTTTGATTTTATATTAGTTTCATGCAATGCAAATTCGA
ATATCAGAGTTCTCCAAGCTTGAAACAAGCAAAACAAGCT
TTCGTTTTCAGCCTGGTGCATTCAGCTACATATGAATGGG
GTGAAAAGTGCAGTGTGACTGAAGCTTTTATGTGTGAACT
ACTGAATGACACATCAAAGAGGCTCGCTCGTGTCGCATAC
AAAAATCTAATATCTAGCAGGACAAACATTCTAAACCAGA
CAGCCGACTCGACACCATGTTATTTCAGATGTAATGACGA
TCTACAGC

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
brd1a-202 Contained in:
OTHER brd1a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000012922 (1)
  • Ensembl_Trans:ENSDART00000145083 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK677936 (1) 620bp
    GenBank:EH580968 (1) 548bp
    GenBank:CK706097 (1) 492bp
    CITATIONS (2)