Transcript

ottdart00000001986

ID
ZDB-TSCRIPT-090929-23230
Name
ottdart00000001986
Previous Names
None
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000001986 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001986|OTTDARG00000001859|ZDB-GENE-010525-1 slc4a1a|OTTDARP00000001759 slc4a1-001 LG_ AL604064.10 Danio rerio protein_coding KNOWN, 3500 bp
AGAATTGGTCTGAGGTCAGTCTTGAGTTGGCACTCGACGT
GAAGACGTGGAAACCCAGCACAGAGACCCGCCAGGACCAC
CTGGGCTCAGGTTATGTGCGAGACTTTCTGAAGTTTCAGG
GACAGAGAGAAGACAGTCTCGATGATGGAAGCTGTTTCAT
TTGATGGGGACAATGACGTGTCCTATGAGGACAGTGAGTC
GCCTCTGCCCTCTCCATTTACCTTGACGCCCGCGGCACAC
AAAGGCAGCTACGATCTAGAACAGGTCAGACAGCAAGGCG
AGGAGCAGCCACAGACCTTCACCTTCAATAGAGACCTAGA
GGCCGCTAGAAATACCAACACCAATGCCATAAAGAGAGGA
GATGCAGAGTCATACGTGGAGCTAAACGAGCTGCGTGGTG
AAATATGGCAGGAGACGGGCCGCTGGGTGGGTTTTGAGGA
GAACTTCAGCCCTGCCACGGGACAGTGGAGCCAGTCCCAT
GTCTCCTACCTCACCTTCAAAAGCCTCATTCAGCTCCGCA
AGGTCATGAGCACAGGGGCTGTGCTGCTGGATGTTGATGA
CAGCAGTTTATCCAGCATTGGCCAGAAGATGGTGGAACAA
CTTCTGCTCAAAAAAGAGATCCGGCCCTCTGACCGTGACG
CTCTCGTCACCATACTGCAACGCAAGCGCAGCCAGTTAGA
GCCTGTTGTATCCCCTGGTTCAGCAGACCTTGAGCTGCAG
ACGTTCTCTGTCACCAAACAGCGAGATCAGGTTGACCGTG
TGGAGGGCTCTGTGGTTTTGTCAGGTGTGGTGGAGAACCT
ACAGAAACCAGTGGTGGCGTTTGCACGTCTGCGGGATTCG
GTGGTGATGGAGGGGGTCCTGGAAGCTTCCATTCCAGTTC
GTTTCGTCTTCTTCCTCGTGGGCCCCAGTCACAGCGGCAT
GGACTATCATGAGAGCGGCCGAGCCATGGCAGCACTGATG
GCCGACTGGGTGTTCTCTCTGGAGGCTTACTTGGCCACTA
ATGAGAGGGATCTGTACAATGCCATGGCAGACTTCATGGA
CTGCAGCATCGTGATCCCACCTACAGACATCCAGGATGAC
AGCATGCTGAAGCCAATTATCAACTTCCAGAAGAAGATGC
TACATGACAGAGTCCGCCCATATGACACTCGAATCATGGT
TGGGGGCAAAGCCCCAACTGGACCTGCAAAGCCAAGAGAG
GATCCACTGGCCCGTACCGGCCTTCCATTTGGTGGTATGG
TCAAAGACATTAAACGCCGCTACAAGCATTACCTTAGTGA
CTTCACTGATGCATTGGACCCTCAAGTGCTGTCTGCTGTC
ATCTTCATCTACTTCGCTGCCCTTTCTCCTGCGATCACCT
TTGGAGGACTTCTTGCGGATAAGACGGAGCACATGATGGG
GGTCTCTGAGATGATGGTCTCCACCTGCGTGCAGGGTGTC
ATCTTTTGTCTCTTTGCGGCTCAACCAGTTCTCGTCATTG
GGTTTACTGGACCATTAATGGTGTTTGAGGAGGCGTTCTT
TCAGTTCTGCAAGGGGTATGGCTTTGAGTACATCGTTGGC
CGTGTTTGGGTGGGCATGTGGCTGATCGTCATTGTGGTGA
TCATTATGGCAGTGGAGGGAAGCTTCCTGGTCCGTTTCAT
CTCGCGCTTCACCCAGGAGATCTTCTCCATTTTGATCTCT
CTCATTTTCATCTACGAGACCTTTTCCAAGCTTATCAAGA
TTTTCAAAGCTCATCCTTTGATCTTGAACTACGAACACTT
AAATGATTCCTTGGATGACCCATTCCATCCAATCAAAAAA
GTTATCAACGTCACTCTTCATCCAGATGGCAATGTAACTG
AACATCATGAAATAATAGAGAGGGCCTATCCTAACACTGC
CCTGCTGTCCATGTGTCTTATGTTTGGCTGTTTCTTCATT
GCCTTGTATCTCCGTGGGTTTAAAACAAGCACCTTCCTTC
CTGGTCCTATCCGTCGGATGGTTGGAGATTTTGGTGTCCC
CATCGCCATCTTCTTCATGATTGCTGTGGATATCAGCATC
AGTGATGCCTACACACAGAAACTGGTGGTGCCAAAGGGTC
TGACCGTGTCCAACACTTCTGCCAGAGGCTGGTTTATCAG
CCCGTTTGGTGAGAAGAAGACATTCCCTGTCTGGATGATG
TTTGCCTGTGTTGTTCCTGCCATGTTGGTCTTCATCCTTA
TTTTCCTTGAGTCCCAGATCACCACGCTGATCGTGAGTAA
ACCTGAGCGGAAAATGGTGAAGGGCTCTGGTTTCCATGTG
GACCTCCTCCTGCTGGTGTTCCTGGGAGGAGTTGGATCTC
TGTTTGGTGTCCCGTGGCTCAGTGCTGCTACTGTGAGGTC
TGTGACCCACGCCAATGCCCTAACCGTCATGACCAAAGGC
CCCAGACCTCAGATTGAACGCGTGTTAGAGCAAAGAGTCA
GTGGGATTTTGGTGGCGGTGATGGTTGGCGTCTCAATTCT
CATGGAGCCCATTCTGAAGATGATTCCTATGACTGCTCTG
TTCGGGATCTTCCTCTACATGGGTATCACTTCACTGAGTG
GCATCCAGCTTTGGGACCGCATGCTCCTGCTCATTACGCC
GAAAAAGCATCATCCGGCTGTTCCATATGTCACCCGTGTG
CCAACTATGCGTATGCACTTGTACACTTTGATCCAAGTGA
TGTGTTTGGCGTTGCTGTGGGTGGTAAAATCGAGTAATTT
CTCACTCGCCCTTCCATTCGTTCTGATCCTCACGATCCCT
CTGAGAATGTTCATGACCGGTCACGTCTTCACTGTTATGG
AAATGAAATGTCTGGATGCTGATGACGCAAACGTGAAATT
TGATGATGAAGACGACTAAAAAAACAATCTCTAGATTCTT
GATTTCTGATTCCAAACCACTATGAATTCATCTCACTGTG
TGCATTACATGAGAATAATTTTGCTTATATTTTTTTAACT
GTTGTACATTCAAATCCCTTAGTTTAACAGGTCAGAAATG
TTGAAGAATGTGATCAATGCACACCTAAAGTTCATAAACT
GTTCATATACATTCCGTAGTTGTTTATCCGAATAGTATGT
TTTCTTACTTTTGCATAGAACATTGTGCTTAAGCTTTTGA
TTTTATTTTATTTTTGTGTGTGTGTTTGTGCCTTTTAAGA
TTTGGGATTAAAACATTATCCTGTTATTTATTTATTTAAA
GTATTCAGGGTTTAATGCAGGAAACTTCACGTTGGAGTGA
GGCATGTCAACTATGCACCAGCTCGATTGTACCCCCGTCC
TGTTTCCACAGGTGATGCCAATGCAAAATATGTGCCTTTA
TATTTCTTATAAGAAGTTGAATGTTTCTGAATTTCGAACA
TCATACCTGTAAATATATTAGGCTTATGATTGTTAGCGTA
GGATAGATTTTACACAGTATAAATGATTCATTTGCTTTAT
GTATGCTTGGTATGTTATGGTGTGTGACTTTGTTTATTGA
TTAAAATTCTTTAAAACATC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations