Transcript

ottdart00000001752

ID
ZDB-TSCRIPT-090929-23200
Name
ottdart00000001752
Previous Names
  • ankar-001
  • busm1-211o13.9-001
  • dZ211O13.9-001
  • si:busm1-211o13.9-001
Transcript Type
mRNA
Annotation Status
fragmented
Associated With Genes
Strain
AB
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000001752 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000001752|OTTDARG00000001639|ZDB-GENE-030616-533 ankar|OTTDARP00000001541 BUSM1-211O13.9-001 LG_ AL591593.11 Danio rerio protein_coding NOVEL, 744 bp
ATGAAGGCTCTCTGGCACGGGTGTCACATCCCTAGGGAGA
GACGCATCCGCTTCTGTGAGCTTTGGAGATCCAGCATGGC
CGTGGATTCAGATGGTGCTCCTCAAACACAGAAAGATGTG
CTTGCAGAGTTTCTCAGTGCAGGTTTAAAAGACATCTCAG
ATGAACCATGTTATCAGGACATTTATAAGGAGAACACTGA
TGCAGACCCAACCTATGAACCCGAAAGCACAGAAGAGGAG
AATCTCTTCTCTCAATACTCAGAAAGCATCCTGATCAAGC
TGAGTGCATTCCTGACCTCTGCCCGCCAGCACCAAAATCT
CTTCATGTTCGAGGGGTCTTATTGCCTGTCCAATGCTGTC
CGACTCACAGAAGACAACATTGATCTGGCCACATACCAGA
GGCTGCAGAAAAGGCTGTCAGAGCACATTATTTTGGTTAA
AAACAACCTTGAGAAGAATGCTGAAGTCTGCAGGGAGCTT
GCTTATCTCAAACTCATCTCGTTCCTTGTGCCGCTGCTCA
TTTCTTTGAGGAAAAAGATGTTGATTCCAAATCTGTCAAA
ATTGCTCTCACCTATGTCAGATGACAAGCTGAAAACAGAA
CGAGAGGTTCCTCCACACCTTCTTGGACCTGAATTTGCCT
GCAAGCACTTCCCTCACAAGCAGAATCAGTATTTTCACCT
TCATGGAGGGATAGAATTTGATTTGGGGACACCTTCTCTT
GATGATGCCACTGAGGAAACGAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations