Transcript

ankar-201

ID
ZDB-TSCRIPT-090929-15188
Name
ankar-201
Previous Names
  • ankar-001
  • ottdart00000034359
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034359 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034359|OTTDARG00000025978|ZDB-GENE-030616-533 ankar|OTTDARP00000027716 ankar-001 LG_ CT737230.12 Danio rerio protein_coding KNOWN, 4334 bp
TCATCCCTTATATCTGAATAAACGCGTGAGGTTTTGATGG
AGAGCAGCGAGAGCGCCGTTCGGGCCGCGTTGACCGCTCA
ATCTTTCCTTCAGAAATATGACCGCAGGGAACTTCAAGAA
CTGCTCAGCCTGACCTCCTGTAACTGGCTACTCTGCGCCG
AAGAGCATAAGCTACCAATAGAGACACCCCCAGGCATCAG
CAAACAACTGAAGAACATCTTACATCCCAACATAATCATT
CTGGCTCCCTCTGGCTCGTGTTTGCCGCTGGATTATACAG
TGGTCCACCAGATAGTGAGGGAACTTACAGTGGGGATTTA
TGGGTTTAACCAAGTTCCTGGGGTCAGTTTACTACCCAAC
TATGACCAGAGCTCCACCTGCTTGTTGCCGCCGGCGTATT
ATGATACCAAGGTCGGTCAGATTTTAATAAGCATAGATTA
TACAATGAAGGCTCTCTGGCACGGGTGTCACATCCCTAGG
GAGAGACGCATCCGCTTCTGTGAGCTTTGGAGATCCAGCA
TGGCCGTGGATTCAGATGGTGCTCCTCAAACACAGAAAGA
TGTGCTTGCAGAGTTTCTCAGTGCAGGTTTAAAAGACATC
TCAGATGAACCATGTTATCAGGACATTTATAAGGAGAACA
CTGATGCAGACCCAACCTATGAACCCGAAAGCACAGAAGA
GGAGAATCTCTTCTCTCAATACTCAGAAAGCATCCTGATC
AAGCTGAGTGCATTCCTGACCTCTGCCCGCCAGCACCAAA
ATCTCTTCATGTTCGAGGGGTCTTATTGCCTGTCCAATGC
TGTCCGACTCACAGAAGACAATATTGATCTGGCCACATAC
CAGAGGCTGCAGAAAAGGCTGTCAGAGCACATTATTTTGG
TTAAAAACAACCTTGAGAAGAATGCTGAAGTCTGCAGGGA
GCTTGCTTATCTCAAACTCATCTCGTTCCTTGTGCCACTG
CTCATTTCTTTGAGGAAAAAGATGTTGATTCCAAATCTGT
CAAAATTGCTCTCACCTATGTCAGATGACAAGCTGAAAAC
AGAACGAGAGGTTCCTCCACACCTTCTTGGACCTGAATTT
GCCTGCAAGCACTTCCCACACAAGCAGAATCAGTATTTTA
ACCTTCATGGAGGGATAGAATTTGATTTGGGGACACCTTC
TCTTGATGATGCCACTGAGGAAACGAAGGTGGCTTTCAAA
ACTCTACAGGCTCAGGCAGCCAATTACCTCTATGAATTGC
TTCGTCAAGACTCTACATACAAAACCCATTTTCCTATACC
ACTCAGTGAGATTGAAGGGAAAAGCTATAATGTCATCTCC
ATTGAGCTAGAGTCATTTTATCCTCAACATAACCTGGTTC
AGTGGTGGGGGGCTTTAAGCTCTTCCATTAAAACCCTCAA
AGAGAAGAGACTGCCTTTAACAGATATTGAGCTACACGAG
CAGTTCAAGAAAACATTTGGCTACACAAAAGCTATGAAGT
GCAAGAATGTGGCGTTTGGGCTGAAGGCGGCAGCAGAGAG
AGGACTATGTGCAGTGTTTTCCTCATTGAGTCGTAGGGTC
CCGCCGTCTCTCCTGCATGCTCTTGATGAGCAGGGTTTCT
CTCTGCTTCATCATGCTGCCATCAACAACCAGACACACAT
CATTGTTCAGCTCGCGGCTGCAGGAGTCAACCTGAACCAG
ACACGCAGCGAGAGATTCACTAACACAGGACAATCAGGGG
TCAGATTCATTGAAGGAGCTGGCCTCACACCAATGCACCT
GGCAGCACAGTGTGGTTCCCTTGAATCCCTGAACTGTCTT
CTAGCACTGCGAGCCGACTACAGAGTTGTGGATAAGAGAG
GTTGGATGGCCATTCATTTTGCAGCCTTTTATGGGCAGGT
GGCATGCATTCAGGTGCTATGTAGGAAAGACCCAACATTA
CTGGAGATGAAGACCCCTGCTGAGTATGGCAGCTCTCCAC
TGTTACTGTCAGCGACCTCAGGTTCAGTGGAAGCTCTGGA
CTTCCTGTTGTCCACAGGGGCAAACTGGAGAGAGGAAGAC
AGCAAGGGAAATAACTGTGTCCACCTGGCAGCTCTTTACT
TTCACACAGATGTCCTTAAACACCTCATTCAGCTCAATCT
GGATGGCCTTCCTGTGTGGAAGATTCTTGTCGAAATGCTC
CAGATTGAGGACTTTAAGCGGATGGAGAAGACCCTCGGGT
GTCTTGAGGCTCTCTGTGTAAACACTGAGTCCTTCAGTGA
GGATATATTGGATGCAGGAGGTGTTCCAGTGCTGGTGAGC
TTGCTTTGTTCAGACAGACAGGTGGTGCAGTGCATGGCTA
CAGCGGTCCTGTGTCATATGACGGAAAACTCACAAGTCTG
TGAAGAACTGGTGCATCATGGTGCTGTACCGATTCTGATC
AAGCTCCTCAGTGTCCATCAGCCCGAGCTGGACTCTCGCT
GTGCTGTTATACTTGCCGATCTGGCCGCACACAGCAAGCA
GCACCAAAGCCTCATTGCTGACTTGGGTGGGGTGGCACTT
GTAGTGAATCTTCTGACCTCTGACCTTCAAGATGTTCTAG
TAAATGGTGTCAGGTGCATCCGTACTTTATGTGTCAGAAG
TCCACACAACCAAACTGCTGTCGCACATGCAGGAGGAGTT
CCACATCTCATCCAGATCCTAGCTGTGGATTCTGATACAC
TGCAAGAAGAGGCCTGTCTGGCTCTTGCTGAATTATCTCG
GGGTCACAGGGAGAATCAGGCACTCATATGTGAGGCAGGA
GCGGTTGGTGCCTTGGTTCAAGCCCTGAGACACAGAAAGA
TATCGGTGAAGGTCAAAGCAGCTTCAGCGCTTGAATCTCT
AGCCAGCCACAATTCTGCCATACAGCAGTGCTTCCTCAGA
CAATCAGCTCCTAAATACCTTCTACAGCTTTTAACGGTGT
TCCAGCTGGACGTACGAGAACAGGGTGCGATTGCTCTGTG
GGCCCTGGCCGGACAATCTCTGAACCAACAGAAACTCATG
GCAGAGCAGATGGGCTACTCTGTTATCCTTGACCTTCTTC
TGTCCCCTTCAGACAAAATACAATACGTGGGATGCCGAGC
GGTGATAGCGCTTAGCCGAGACAGTCGTATCCATCAGAAT
GGCTTTTGCAGGGAAAACGGAGTGCCACCATTAGTGCGCT
TGCTTCGAGGGTCTCGAACAGGACAGAAGACCCTGCTTAG
TGTCATCGAAGCCTTGGGATGTTTGTGCATTGGAGTGGCG
CTCACTACAAATAAAAACAGCCAGAAGACTGTTTACAGAG
AACAGGCCATTCCTACTTTATTAGAGCTTTTAAAAGCACA
CAAATCTCAGGAGATCAAGGTGCAAGTAGCTCAGACTCTC
GCTTGTGTGCTGCTGGGAAACCAAAAACTTCAAAGGGAAT
TTTGGGAACAAGAGGACTTCTCTTATGAGAACATTGTTGA
GCTCCTAAATGCTGAAAATAAAAACATTTCTCTGGACGCT
GGACATGCATTATCCCTGTTTGCATACAACAGCAAAGCAC
ATCAGAAGGCGATACGACAACTGGGAGGAATTCCAGGAAA
AATATATGAGACTTTTCTGAACTCTGACAATGAAACAGAA
AAAGCAAAAGCTGCATTTCAGACAGTTGTGTTGGCTAGAG
TAATCAGTGGGTCAGATGAAGTGACTTTGACTGCGAGGGG
AGTAACTATTCTTGTTGAATTATTACAGTCTGACCAATCC
ACTACTGTGATCATTACAGCACAACTTCTTGCTAGTCTTG
CTCACATGAGAGCAGGTATTACTGATGCCATTGTCAGCAT
GGGTGCCACAGAGCATCTGTCTGCTCATCTGGATTCAGAA
GATGAAGAGGTTAGAACAGCTTGTACAAGCGCTCTGGGTT
ACCTGACCTTCAATCGTTATGCTCATCGACAGCTTATGAC
AAAATGTAGAAAATCCCCTCACATTTATGACCTCCTAATG
AAGAATCTAGCTCCAGACGCTAGAATATCCCAATTGTTTA
CAGCAGAGTTTGAAAGACAGAGAAGAATAGGCTTTCCGTC
CCTCAGTTTGGGGATAAACGGCGGCCCTCCTGTGTCTCCT
GGTAATAATAAAGGACCGTCGAAGAAACTGAACACTAGGG
GTAGTCAGTCAGCAGTCGGCGAGAGGGAAACATCGGCTCC
TTCAGTGCATCATGTAGGACAGAGGACCAAAAGCGCTCAT
CCCAAATTCAGACCCGGACGGACGCCCTGCCAACACTGAG
GTTAAATGAAAATACCTGAAAAGCCCAGAACTACGGCTCT
GCTGTTTACACCAAAAGGTGGCAAAAGCTGAAATAAAAGC
GCATGCAAAACAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations